@ARTICLE{TreeBASE2Ref19996,
author = {Germinal Rouhan and Paulo H. Labiak and Emile Randrianjohany and France Rakotondrainibe},
title = {Not so Neotropical after all: the Grammitid Fern Genus Leucotrichum (Polypodiaceae) is also Paleotropical, as Revealed by a New Species from Madagascar},
year = {2011},
keywords = {cpDNA, Grammitidaceae, Indian Ocean, long-distance dispersal, phylogeny, pteridophytes},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Based on morphological and molecular evidence (DNA sequences from six plastid regions: atpB, rbcL, trnG-trnR, trnL-trnF, atpB-rbcL, and rps4-trnS), the new fern species Leucotrichum madagascariense is described from Madagascar, where it is found in the North (Marojejy), the Centre (Andringitra), and the South (Andohahela) regions. Leucotrichum madagascariense exhibits whitish and long laminar hairs, among the other distinguishing characters of the genus: arching fronds, laminar apices subconform to the lateral pinnae, dark sclerenchyma covered by the green laminar tissue, and laterally marginate petioles. Its most remarkable feature is the lack of the rhizome scales, a character that is shared with the Neotropical L. pseudomitchellae. However, our phylogenetic results suggest that this character has evolved twice independently within the genus. In contrast, the sister relationship between the new Madagascan species and the group composed of L. schenckii and L mortonii is morphologically supported by linear and deeply pinnatifid laminae, incised 2/3?3/4 of the way to the rachis along its length. Leucotrichum madagascariense is the only representative of the genus occurring in the Old World. Because it is nested within a clade of five Neotropical species, we hypothesize that its occurrence outside the Neotropics results from one long-distance dispersal event from America, likely Southeastern Brazil, to Madagascar.}
}
Matrix 10204 of Study 11865

Citation title:
"Not so Neotropical after all: the Grammitid Fern Genus Leucotrichum (Polypodiaceae) is also Paleotropical, as Revealed by a New Species from Madagascar".

Study name:
"Not so Neotropical after all: the Grammitid Fern Genus Leucotrichum (Polypodiaceae) is also Paleotropical, as Revealed by a New Species from Madagascar".

This study is part of submission 11865
(Status: Published).
Matrices
Title: Leucotrichum 6 cpDNA
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Alansmia cultrata Dassler94 |
(none)
|
GCTTTCTCACCAGGAGAAATGCCTAATATC |
Alansmia cultrata MS1136 |
(none)
|
?????????????????????????????? |
Alansmia cultrata MS1162 |
(none)
|
?????????????????????????????? |
Alansmia cultrata MS1214 |
(none)
|
?????????????????????????????? |
Alansmia glandulifera MS1765 |
(none)
|
?????????????????????????????? |
Alansmia lanigera Leon3647 |
(none)
|
GCTTCCTCGCCAGGAGAAATGCCTAATATC |
Alansmia lanigera Rojas3207 |
(none)
|
GCTTCCTCGCCAGGAGAAATGCCTAATATC |
Alansmia senilis MS1156 |
(none)
|
?????????????????????????????? |
Alansmia senilis Rojas3196 |
(none)
|
GCTTCCTCGCCAGGAGAAATGCCTAATATT |
Alansmia stella MS1083 |
(none)
|
?????????????????????????????? |
Leucotrichum madagascariense RG287 |
(none)
|
?????????????????????????????? |
Leucotrichum mitchellae BA48307 |
(none)
|
?????????????????????????????? |
Leucotrichum mitchellae MO3141 |
(none)
|
?????????????????????????????? |
Leucotrichum mitchellae VA195 |
(none)
|
?????????????????????????????? |
Leucotrichum mortonii LI16026 |
(none)
|
?????????????????????????????? |
Leucotrichum organense PL3630 |
(none)
|
?????????????????????????????? |
Leucotrichum organense PL4232 |
(none)
|
?????????????????????????????? |
Leucotrichum organense PL4302 |
(none)
|
?????????????????????????????? |
Leucotrichum pseudomitchellae Rojas3005 |
(none)
|
GCTTTCTCGCCAGGAGAAATGCCTAATATC |
Leucotrichum schenckii JP1664 |
(none)
|
?????????????????????????????? |
Leucotrichum schenkii Salino4538 |
(none)
|
GCTTCCTCGCCTGGAGAAATGCCTAATATC |
Columns
None of the columns has a description.