@ARTICLE{TreeBASE2Ref14640,
author = {C. Donovan Bailey and Robert A. Price and Jeff J. Doyle},
title = {Systematics of the halimolobine Brassicaceae: evidence from three loci and morphology.},
year = {2001},
keywords = {},
doi = {10.1043/0363-6445-27.2.318},
url = {http://www.jstor.org/stable/3093874},
pmid = {},
journal = {Systematic Botany},
volume = {27},
number = {2},
pages = {318--332},
abstract = {Relationships among Halimolobos, Mancoa, Pennellia, and Sphaerocardamum have been controversial. Higher level studies, using DNA sequence data from the chloroplast encoded ndhF and trnL intron, suggested that some species of these genera represent a monophyletic group: the halimolobine clade. The research presented here focuses on the halimolobine clade with denser intra and inter-specific sampling. The primary aims of the project were: (1) to further test the monophyly of the halimolobine clade; (2) to test the monophyly Halimolobos, Mancoa, Pennellia, and Sphaerocardamum; and (3) to study the evolution of morphological characters in the clade. Data were generated from the chloroplast trnL region, nrDNA ITS, pistillata intron one, and 17 non-molecular characters. The difficulties associated with incorporating these data into simultaneous analyses are discussed and a strategy is presented. Separate and simultaneous analysis confirmed a monophyletic core group of halimolobine species. The strict consensus tree contained five well-supported halimolobine subclades: Sphaerocardamum, Pennellia plus Arabis tricornuta, Mancoa bracteata plus M. foliosa, a narrowly defined Halimolobos group, and a clade consisting of a subset of both Halimolobos and Mancoa species. Individual morphological characters vary in their utility for classification of the group. However, the majority of the characters provide some grouping information within the halimolobine clade.}
}
Matrix 10252 of Study 780

Citation title:
"Systematics of the halimolobine Brassicaceae: evidence from three loci and morphology.".

This study was previously identified under the legacy study ID S635
(Status: Published).
Matrices
Title: BEAST Dating Analysis Alignment
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Varanus yemenensis MVZ236610 |
(none)
|
TGGTCAGAGTTACCGAGCAACAGGTTGATT |
Ramphotyphlops braminus |
(none)
|
??------GTCAGCAATGAACAGCCTGATG |
Cylindrophis ruffus |
(none)
|
TG---GACATCACTGATGAACAGCCTAATG |
Agkistrodon strauchii |
(none)
|
TG---GACATCACTGATGAACAACCTAAGG |
Dinodon rufozonatum |
(none)
|
TG---GACATCACTGACGAACAACCTAAGG |
Varanus albigularis albigularis AMB8890 |
(none)
|
?????????????????????????????? |
Heloderma suspectum |
(none)
|
TGGACAAAGTCAACGAGCAACAGGCTGATG |
Elgaria panaminta |
(none)
|
TGGACAAAGTCGCCGAGCAACAGCCTGATG |
Shinisaurus crocodilurus |
(none)
|
TGGACAAAGTCACCGAGGAATGGGCTGATG |
Xenosaurus grandis |
(none)
|
TGGACAAAGTCGCTGAGGAACAGGCTGATG |
Lanthanotus borneensis |
(none)
|
TGGACAGAGTCGGTGAGGAACAGGTTGATG |
Varanus ornatus CAS207622 |
(none)
|
?????????????????????????????? |
Varanus sp CAS238226 |
(none)
|
?????????????????????????????? |
Varanus salvator CAS212911 |
(none)
|
??????????????GAGCAACAGG{CT}TG |
Varanus bengalensis MVZ237483 |
(none)
|
TGGTCAGAGTCACCGAGCAGCAGGTTGATT |
Varanus niloticus MVZ238936 |
(none)
|
TGGTCAGAGTTACCGAGCAACAGGTTGATT |
Varanus griseus MVZ236611 |
(none)
|
TGGTCAGAGTCGCCGAGCAACAGGTTGATT |
Varanus albigularis microstictus MVZ241418 |
(none)
|
TGGTCAGAGTTACCGAGCAACAGGTTGATT |
Varanus exanthematicus MVZ238935 |
(none)
|
TGGTCAGAGTTACCGAGCAACAGGTTGATT |
Columns
None of the columns has a description.