@ARTICLE{TreeBASE2Ref20062,
author = {F. Keith Barker and Scott M Lanyon},
title = {The Impact of Parsimony Weighting Schemes on Inferred Relationships among Toucans and Neotropical Barbets (Aves: Piciformes).},
year = {2000},
keywords = {},
doi = {10.1006/mpev.2000.0752},
url = {http://},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {15},
number = {2},
pages = {215--234},
abstract = {The development of new schemes for weighting DNA sequence data for phylogenetic analysis continues to outpace the development of consensus on the most appropriate weights. The present study is an explora- tion of the similarities and differences between results from 22 character weighting schemes when applied to a study of barbet and toucan (traditional avian fami- lies Capitonidae and Ramphastidae) phylogenetic rela- tionships. The dataset comprises cytochrome b se- quences for representatives of all toucan and Neotropical barbet genera, as well as for several gen- era of Paleotropical barbets. The 22 weighting schemes produced conflicting patterns of relationship among taxa, often with conflicting patterns each receiving strong bootstrap support. Use of multiple weighting schemes helped to identify the source within the dataset (codon position, transitions, transversions) of the various putative phylogenetic signals. Impor- tantly, some phylogenetic hypotheses were consis- tently supported despite the wide range of weights employed. The use of phylogenetic frameworks to summarize the results of these multiple analyses proved very informative. Relationships among barbets and toucans inferred from these data support the paraphyly of the traditional Capitonidae. Additionally, these data support paraphyly of Neotropical barbets, but rather than indicating a relationship between Semnornis and toucans, as previously suggested by morphological data, most analyses indicate a basal position of Semnornis within the Neotropical radia- tion. The cytochrome b data also allow inference of relationships among toucans. Supported hypotheses include Ramphastos as the sister to all other toucans, a close relationship of Baillonius and Pteroglossus with these two genera as the sister group to an (Andigena, Selenidera) clade, and the latter four genera as a sister group to Aulacorhynchus.}
}
Matrix 10331 of Study 11941

Citation title:
"The Impact of Parsimony Weighting Schemes on Inferred Relationships among Toucans and Neotropical Barbets (Aves: Piciformes).".

Study name:
"The Impact of Parsimony Weighting Schemes on Inferred Relationships among Toucans and Neotropical Barbets (Aves: Piciformes).".

This study is part of submission 11941
(Status: Published).
Matrices
Title: Toucan Barbet cytb
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Trachyphonus darnaudii |
(none)
|
CTTCGGCTCCTTACTCGGCATCTGCCTAAT |
Lybius bidentatus |
(none)
|
-------------------------CTAAT |
Pogoniulus bilineatus |
(none)
|
-------------------------TTAAT |
Psilopogon pyrolophus |
(none)
|
TTTCGGATCCCTCCTAGGCATCTGCTTAAT |
Megalaima mystacophanos |
(none)
|
CTTTGGGTCTCTCCTAGGAATCTGCTTAAT |
Capito dayi 1 |
(none)
|
-------------------------CTGGT |
Capito dayi 2 |
(none)
|
CT??GGGTCACTCC??GGT?TC?GCCTGGT |
Capito niger |
(none)
|
-------------------------CTTGC |
Eubucco richardsoni |
(none)
|
CTTCGGATCCCTCCTTGGCATCTGCCTCGC |
Eubucco bourcierii tucinkae |
(none)
|
CTTCGGATCCCTCCTCGGTATCTGCCTCCT |
Semnornis frantzii |
(none)
|
CTTCGGATCCCTCCTTGGCATCTGCCTAAT |
Semnornis ramphastinus |
(none)
|
GTTCGGATCCCTCCTCGGCATTTGCCTAAT |
Aulacorhynchus derbianus |
(none)
|
-------------------------CTCGT |
Pteroglossus inscriptus |
(none)
|
TTTCGGATCCTTCCTAGGCATGTGCCTCAC |
Pteroglossus castanotis |
(none)
|
TTTCGGATCTCTCCTAGGCATCTGCCTCGC |
Selenidera gouldii |
(none)
|
TTTGGGATCCGTATTAGGC?TCTGCCTCGC |
Selenidera spectabilis |
(none)
|
CTTCGGATCTCTCCTAGGCAT?TGCCTAGC |
Baillonius bailloni |
(none)
|
TTT?GGATCCCTCCTAGGCATCTGCCTCAC |
Andigena hypoglauca |
(none)
|
CTT?GGGTCACTACTAGGCATCTGCCTCAC |
Andigena laminirostris |
(none)
|
CTT?GGATCACTACTAGGCATCTGCCTCGC |
Ramphastos vitellinus culminatus |
(none)
|
------------------------------ |
Ramphastos tucanus cuvieri |
(none)
|
-------------------------CTCAT |
Picumnus aurifrons |
(none)
|
-TT?GGCTCCCTTCTAGGCATTTGCCTAAT |
Colaptes auratus |
(none)
|
--TCGGATCCCTCCTCGGTATCTGCCTACT |
Colaptes rupicola |
(none)
|
TTTCGGATCCCTCCTCGGCATCTGCTTACT |
Piculus rubiginosus |
(none)
|
-TTCGGATCCCTCCTCGGCATCTGCCTACT |
Dryocopus pileatus |
(none)
|
----GGATCCCTCCTCGG?ATCTGCCTGAT |
Sphyrapicus varius 1 |
(none)
|
-------------------------TTATT |
Sphyrapicus varius 2 |
(none)
|
-TTCGGATCCCTTCTCGGAATCTGCTTGTT |
Veniliornis callonotus |
(none)
|
CTTTGGATCCCTCCTAGGCATTTGCCTAGT |
Veniliornis nigriceps |
(none)
|
ATTTGGATCTCTTCTAGGCATTTGCCTAAT |
Picoides villosus |
(none)
|
?TTTGGATCCCTCTTAGGCATCTGCCTAGT |
Campephilus haematogaster |
(none)
|
--TCGGATCTCTCCTCGG?ATCTGCCTAAT |
Columns
None of the columns has a description.