@ARTICLE{TreeBASE2Ref20162,
author = {Pedro W. Crous and Bret A. Summerell and L. Swart and Sandra Denman and J. E. Taylor and Karien Bezuidenhout and Mary E. Palm and Seonju Marincowitz and Johannes (Ewald) Zacharias Groenewald},
title = {Fungal pathogens of Proteaceae},
year = {2011},
keywords = {biodiversity, cut-flower industry, fungal pathogens, ITS, LSU, phylogeny, systematics},
doi = {10.3767/003158511X606239},
url = {http://www.ingentaconnect.com/content/nhn/pimj},
pmid = {},
journal = {Persoonia},
volume = {27},
number = {},
pages = {20--45},
abstract = {Species of Leucadendron, Leucospermum and Protea (Proteaceae) are in high demand for the international floriculture market due to their brightly coloured and textured flowers or bracts. Fungal pathogens, however, create a serious problem in cultivating flawless blooms. The aim of the present study was to characterise several of these pathogens using morphology, culture characteristics, and DNA sequence data of the rRNA-ITS and LSU genes. In some cases additional genes such as TEF 1-α and CHS were also sequenced. Based on the results of this study, several novel species and genera are described. Brunneosphaerella leaf blight is shown to be caused by three species, namely B. jonkershoekensis on Protea repens, B. nitidae sp. nov. on Protea nitida and B. protearum on a wide host range of Protea spp. (South Africa). Coniothyrium-like species associated with Coniothyrium leaf spot are allocated to other genera, namely Curreya grandicipis on Protea grandiceps, and Microsphaeropsis proteae on P. nitida (South Africa). Diaporthe leucospermi is described on Leucospermum sp. (Australia), and Diplodina microsperma newly reported on Protea sp. (New Zealand). Pyrenophora blight is caused by a novel species, Pyrenophora leucospermi, and not Drechslera biseptata or D. dematoidea as previously reported. Fusicladium proteae is described on Protea sp. (South Africa), Pestalotiopsis protearum on Leucospermum cuneiforme (Zimbabwe), Ramularia vizellae and R. stellenboschensis on Protea spp. (South Africa), and Teratosphaeria capensis on Protea spp. (Portugal, South Africa). Aureobasidium leaf spot is shown to be caused by two species, namely A. proteae comb. nov. on Protea spp. (South Africa), and A. leucospermi sp. nov. on Leucospermum spp. (Indonesia, Portugal, South Africa). Novel genera and species elucidated in this study include Gordonomyces mucovaginatus and Pseudopassalora gouriqua (hyphomycetes), and Xenoconiothyrium catenata (coelomycete), all on Protea spp. (South Africa).}
}
Matrix 10668 of Study 12058

Citation title:
"Fungal pathogens of Proteaceae".

Study name:
"Fungal pathogens of Proteaceae".

This study is part of submission 12058
(Status: Published).
Matrices
Title: Drechslera Combined
Description: Combined ITS, TEF and CHS phylogeny
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Brunneosphaerella jonkershoekensis CPC 13908 |
(none)
|
------------------------------ |
Drechslera dematioidea CBS 108962 |
(none)
|
------------------------------ |
Drechslera dematioidea CBS 108963 |
(none)
|
------------------------------ |
Drechslera biseptata CBS 306.69 |
(none)
|
TGTACACACCGCCCGTCGCTACTACCGATT |
Drechslera biseptata CBS 308.69 |
(none)
|
-GTACACACCGCCCGTCGCTACTACCGATT |
Pyrenophora leucospermi CBS 111083 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111084 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111085 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111086 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CPC 13777 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CPC 13786 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CPC 16268 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111505 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111862 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 114493 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 114131 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 114033 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 114032 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 115178 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 115397 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111180 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111087 |
(none)
|
------------------------------ |
Pyrenophora leucospermi CBS 111863 |
(none)
|
------------------------------ |
Columns
None of the columns has a description.