@ARTICLE{TreeBASE2Ref18194,
author = {Gert Worheide and Scott A. Nichols and Julia Goldberg},
title = {Intragenomic variation of the rDNA internal transcribed spacers in sponges (Phylum Porifera): implications for phylogenetic studies},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {The internal transcribed spacer regions (ITS1 and ITS2) of the tandemly repeated nuclear ribosomal DNA clusters are frequently used as markers for fine scale analyses in diverse animals. In certain taxa, ITS is nearly exclusively used for population level or inter-specific studies, despite the frequent presence of divergent paralogs within individual genomes that can be phylogenetically confounding. For the first time, we survey diverse marine sponges to determine the extent and phylogenetic implications of intragenomic polymorphisms (IGPs) exhibited at their ITS loci. We discover that the extent of IGP varies greatly between taxa (with most taxa exhibiting very few) and cannot be predicted by taxonomy. Furthermore, we demonstrate that ITS can be phylogenetically informative between species when moderate levels of IGPs are detected, but that ITS paralogy can interfere with population level studies. We caution against the routine use of ITS in phylogenetic studies of sponges without 1) screening for IGPs in every specimen sampled; 2) including all divergent paralogs in phylogenetic analyses; 3) testing ITS data using other single-copy, unlinked loci (such as nuclear introns).}
}
Matrix 1273 of Study 1214

Citation title:
"Intragenomic variation of the rDNA internal transcribed spacers in sponges (Phylum Porifera): implications for phylogenetic studies".

This study was previously identified under the legacy study ID S1127
(Status: Published).
Matrices
Title: Leucettidae ITS
Description: Legacy TreeBASE Matrix ID = M1934
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Leucaltis clathria 6089-PCR |
(none)
|
GGATTGTGGCTACGGGGATTTCGGTCTCTG |
Leucaltis clathria 6022-01 |
(none)
|
GGATTGTGGCTACGGGGATTTCGGTCTCTG |
Leucetta microraphis 3659-PCR |
(none)
|
------------CGGGGATTTCGGTCTCTG |
Leucetta microraphis 3659-03 |
(none)
|
GGATTGTGGCTACGGGGATTTCGGTCTCTG |
Leucetta microraphis 3659-01 |
(none)
|
GGATTGTGGCTACGGGGATTTCGGTCTCTG |
Pericharax sp. 6099-PCR |
(none)
|
-------GGCTACGGGGACTTCGGTCTCTG |
Pericharax sp. 6098-PCR |
(none)
|
-------------------TTCGGTCTCTG |
Pericharax sp. 6098-01 |
(none)
|
GGATTGTGGCTACGGGGACTTCGGTCTCTG |
Pericharax sp. 3791-PCR |
(none)
|
------------------------------ |
Pericharax sp. 3696-PCR |
(none)
|
------------CGGAGACTTCGGTCTCTG |
Pericharax sp. 3696-01 |
(none)
|
GGATTGTGGCTACGGAGACTTCGGTCTCTG |
Leucetta villosa 3662-01 |
(none)
|
GGATTGTGGCAACGGGGATT{CT}CGGTCT |
Leucetta chagosensis 3946-PCR |
(none)
|
-----------------ATTTCGGTCTCTG |
Leucetta chagosensis 3908-PCR |
(none)
|
----TGTGGCAACGGGGATTTCGGTCTCTG |
Leucetta chagosensis 3908-01 |
(none)
|
GGATTGTGGCAACGGGGATTTCGGTCTCTG |
Leucetta chagosensis 3658-PCR |
(none)
|
----------AACGGGGATTTCGGTCTCTG |
Leucetta chagosensis 6085-PCR |
(none)
|
----------AACGGGGATTCCGGTCTCTG |
Leucetta chagosensis 6084-PCR |
(none)
|
----------AACGGGGATTCCGGTCTCTG |
Leucetta chagosensis 6084-01 |
(none)
|
GGATTGTGGCAACGGGGATTCCGGTCTCTG |
Leucetta chagosensis 3658 |
(none)
|
GGATTGTGGCAACGGGGATTTCGGTCTCTG |
Columns
None of the columns has a description.