CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 12720 of Study 12340

About Citation title: "Complex Evolution in Arundinarieae (Poaceae: Bambusoideae): Incongruence between plastid and nuclear GBSSI gene phylogenies.".
About Study name: "Complex Evolution in Arundinarieae (Poaceae: Bambusoideae): Incongruence between plastid and nuclear GBSSI gene phylogenies.".
About This study is part of submission 12340 (Status: Published).

Matrices

Title: GBSSI

Rows

Taxon Label Row Segments Characters 1–30
Neomicrocalamus prainii A  (none) GGCATGGACGTCAGCGAGTGGGATCCCAGC
Neomicrocalamus prainii B  (none) GGCATGGACGTCAGCGAGTGGGATCCCAGC
Dendrocalamus farinosus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Dendrocalamus farinosus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bambusa ventricosa A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bambusa ventricosa B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bonia amplexicaulis  (none) GGCATGGACGTCAGCGAGTGGGATCCCAGC
Bonia levigata  (none) GGCATGGACGTCAGCGAGTGGGATCCCAGC
Indocalamus wilsonii Zeng & S.D.Zhang 07119  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Oligostachyum shiuyingianum A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Oligostachyum shiuyingianum B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa cantorii A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa cantorii B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Yushania brevipaniculata  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia qinlingensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia qinlingensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia decurvata A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia decurvata B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus wilsonii Zhang 07088  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus sinicus Zhang 08034  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia nitida A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia nitida B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus cibarius  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa usawae A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa usawae B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gaoligongshania megalothyrsa  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa longiligulata  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa guanxianensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa guanxianensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa acutivagina  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus sp A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus sp B  (none) GGCATGGATGTCAGCGAGTGGGATCCGAGC
Chimonobambusa sichuanensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonobambusa sichuanensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa shibataeoides A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa shibataeoides B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Brachystachyum densiflorum A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Brachystachyum densiflorum B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa sinica A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa sinica B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa sinica  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Yushania basihirsuta  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus sp2 A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus sp2 B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa qingyuanensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa qingyuanensis B  (none) GGCATGGATGTCAGCGAGTGGGATCCGAGC
Gelidocalamus rutilans A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus rutilans B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Yushania baishanzuensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa guangxiensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus barbatus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa oshidensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa oshidensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus tessellatus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus tessellatus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus longiauritus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus longiauritus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa purpurea A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa purpurea B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonobambusa macrophylla A  (none) GGCATGGACGTCAGCGAGTGGGGTCCGAGC
Chimonobambusa macrophylla B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania qingchengshanensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia fungosa  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Arundinaria appalachiana  (none) GGCATGGACGTCAGCGAGTGGGATCCGATC
Oligostachyum oedogonatum  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Arundinaria gigantea  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Oligostachyum sulcatum A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Oligostachyum sulcatum B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Arundinaria tecta  (none) GGCATGGACGTCAGCGAGTGGGATCCGATC
Pleioblastus gramineus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus gramineus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus intermedius A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus intermedius B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus amarus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus amarus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonobambusa szechuanensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonobambusa szechuanensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa kurilensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania yongdeensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania yongdeensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania fangiana A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania fangiana B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania qiaojiaensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania qiaojiaensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania abietina  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania spanostachya A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania spanostachya B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus solidus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus solidus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa japonica A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa japonica B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa japonica var tsutsumiana A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa japonica var tsutsumiana B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa gracilis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sinobambusa tootsik A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sinobambusa tootsik B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sinobambusa intermedia A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sinobambusa intermedia B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Phyllostachys edulis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Phyllostachys nigra A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Phyllostachys nigra B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Oligostachyum scabriflorum A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Oligostachyum scabriflorum B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa palmata A  (none) GGCATGGATGTCAGCGAGTGGGATCCGAGC
Sasa palmata B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus pallens A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus pallens B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus longiusculus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus longiusculus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus montanus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus dumosus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus dumosus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus jinpingensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus tongchunensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa chinensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa chinensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus juxianensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus juxianensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasaella ramosa A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasaella ramosa B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus maculatus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus maculatus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa chienouensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa chienouensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa gigantea A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa gigantea B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus pseudosinicus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Acidosasa notata  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa amabilis var convexa A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa amabilis var convexa B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Shibataea lanceifolia  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Shibataea nanpingensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus sanmingensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus sanmingensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus wuyishanensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus yixingensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pleioblastus yixingensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa veitchii A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa veitchii B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa amabilis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Chimonocalamus pallens  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus hirsutissimus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Phyllostachys nidularia A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Phyllostachys nidularia B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania fargesii A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania fargesii B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania aristata A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Bashania aristata B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa senanensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indosasa crassiflora  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus sinicus Zeng & Zhang 06081  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa tsuboiana  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus wuxiensis A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus wuxiensis B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa maculifera A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Pseudosasa maculifera B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Sasa magnonoda  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Himalayacalamus falconeri A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Himalayacalamus falconeri B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Drepanostachyum ampullare  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Fargesia macclureana  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Yushania yadongensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus spathiflorus A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus spathiflorus B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus spathiflorus var crassinodus G78 A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus spathiflorus var crassinodus G78 B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus spathiflorus var crassinodus G93 A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus spathiflorus var crassinodus G93 B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus sp1 A  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Gelidocalamus sp1 B  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Ferrocalamus strictus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus hirtivaginatus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Indocalamus emeiensis  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Yushania alpina  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Ampelocalamus scandens  (none) GGCATGGACGTCAGCGAGTGGGATCCGAAC
Ampelocalamus patellaris  (none) GGCATGGACGTCAGCGAGTGGGATCCGAAC
Drepanostachyum hookerianum  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC
Thamnocalamus tessellatus  (none) GGCATGGACGTCAGCGAGTGGGATCCGAGC

Columns

None of the columns has a description.