CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 12721 of Study 12340

About Citation title: "Complex Evolution in Arundinarieae (Poaceae: Bambusoideae): Incongruence between plastid and nuclear GBSSI gene phylogenies.".
About Study name: "Complex Evolution in Arundinarieae (Poaceae: Bambusoideae): Incongruence between plastid and nuclear GBSSI gene phylogenies.".
About This study is part of submission 12340 (Status: Published).

Matrices

Title: 8 plastid all

Rows

Taxon Label Row Segments Characters 1–30
Pseudosasa guanxianensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa acutivagina  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonobambusa sichuanensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indosasa shibataeoides  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indosasa sinica  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania fangiana  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Acidosasa purpurea  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Arundinaria appalachiana  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Oligostachyum oedogonatum  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Oligostachyum sulcatum  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Arundinaria tecta  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus gramineus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus intermedius  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa japonica  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa japonica var tsutsumiana  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa gracilis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sinobambusa tootsik  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sinobambusa intermedia  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Oligostachyum scabriflorum  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonocalamus fimbriatus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonocalamus longiusculus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonocalamus montanus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonocalamus dumosus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus jinpingensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus tongchunensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Acidosasa chinensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus juxianensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Acidosasa chienouensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indosasa gigantea  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Acidosasa notata  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa amabilis var convexa  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Shibataea lanceifolia  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Shibataea nanpingensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus sanmingensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus wuyishanensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus maculatus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus yixingensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonocalamus pallens  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Phyllostachys nidularia  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania fargesii  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania aristata  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa amabilis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indosasa crassiflora  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa maculifera  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Oligostachyum shiuyingianum  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa cantorii  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Yushania brevipaniculata  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Fargesia decurvata  (none) ???ACATTCCTCTAATTTCATTGCAAAGTG
Thamnocalamus spathiflorus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Thamnocalamus spathiflorus var crassinodus G93  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Thamnocalamus spathiflorus var crassinodus G78  (none) ???ACATTCCTCTAATTTCATTGCAAAGTG
Yushania yadongensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Drepanostachyum ampullare  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Himalayacalamus falconeri  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Ampelocalamus actinotrichus  (none) ???ACATTCCTCTAATTTCATTGCAAAGTG
Ampelocalamus patellaris  (none) ???ACATTCCTCTAATTTCATTGCAAAGTG
Fargesia macclureana  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Fargesia qinlingensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus sp  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus pseudosinicus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa longiligulata  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa magnonoda  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa guangxiensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus barbatus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Gelidocalamus sp1  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Ferrocalamus strictus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa qingyuanensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus emeiensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa sinica  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus wilsonii Zeng & S.D. Zhang 07119  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus wilsonii Zhang 07088b  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus hirtivaginatus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus wuxiensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa senanensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa shimidzuana  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Drepanostachyum hookerianum  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Ampelocalamus scandens  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Fargesia nitida  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Gaoligongshania megalothyrsa  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonobambusa macrophylla  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Yushania baishanzuensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonobambusa szechuanensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Thamnocalamus tessellatus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Yushania basihirsuta  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Brachystachyum densiflorum  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Fargesia fungosa  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus solidus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pleioblastus amarus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Phyllostachys nigra  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Phyllostachys edulis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Arundinaria gigantea  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa oshidensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa kurilensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa veitchii  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa tsuboiana  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Sasa palmata  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania qiaojiaensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania abietina  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania spanostachya  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania qingchengshanensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus hirsutissimus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus longiauritus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Gelidocalamus rutilans  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Gelidocalamus sp2  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus sinicus Zeng & Zhang 06081  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Indocalamus sinicus Zhang 08034  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Gelidocalamus tessellatus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Yushania alpina  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bashania yongdeensis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Chimonocalamus cibarius  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Pseudosasa usawae  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Neomicrocalamus prainii  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Dendrocalamus farinosus  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bambusa ventricosa  (none) CAAACATTCCTC-AATTTCATTGCAAAGTG
Bonia levigata  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG
Bonia amplexicaulis  (none) CAAACATTCCTCTAATTTCATTGCAAAGTG

Columns

None of the columns has a description.