CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 14942 of Study 12364

About Citation title: "Miocene/Pliocene dominated diversification in the lichen-forming fungal genus Melanohalea (Parmeliaceae, Ascomycota) and Pleistocene population expansions".
About Study name: "Miocene/Pliocene dominated diversification in the lichen-forming fungal genus Melanohalea (Parmeliaceae, Ascomycota) and Pleistocene population expansions".
About This study is part of submission 12364 (Status: Published).

Matrices

Title: Strobilomyces atp6 cox3

Description: Nucleotide sequences of the atp6 gene and cox3 gene

Rows

Taxon Label Row Segments Characters 1?–30
Boletus edulis  (none) GTAATGTATATGCAAGGTTACTATTCTGGT
Strobilomyces aff. confusus s103  (none) GTAATGTTTATGCAAGGTTACTATTCTGGA
Strobilomyces aff. confusus s138  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. confusus s139  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. confusus s164  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. confusus s348  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. confusus s381  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. confusus s399  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. strobilaceus s309  (none) GTTATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. strobilaceus s380  (none) GTAATGTTTATGCAAGGTTATTATTCTGGT
Strobilomyces aff. strobilaceus s388  (none) GTAATGTTTATGCAAGGTTATTATTCTGGT
Strobilomyces aff. strobilaceus s427  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. strobilaceus s438  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. strobilaceus s441  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces aff. strobilaceus s469  (none) GTAATGTTTATGCAAGGTTATTATTCTGGT
Strobilomyces hongoi s372  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces hongoi s373  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces hongoi s390  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces mirandus s310  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces seminudus s428  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces seminudus s454  (none) GTAATGTTTATGCAAGGTTACTATTCTGGT
Strobilomyces verruculosus s359  (none) GTAATGTTTATGCAAGGTTACTATTCAGGT

Columns

None of the columns has a description.