@ARTICLE{TreeBASE2Ref16676,
author = {Susan L. F. Meyer and Lynn Kay Carta and Stephen A. Rehner},
title = {Morphological variability and molecular phylogeny of the nematophagous fungus Monacrosporium drechsleri},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {An isolate of the nematode-trapping fungus Monacrosporium drechsleri was collected from cultures of the root-knot nematode Meloidogyne arenaria that had been maintained on tomato roots in greenhouse pots in Beltsville, Maryland, USA. To study host range of the isolate, the plant-parasitic nematodes Heterodera glycines, Meloidogyne incognita, and Pratylenchus zeae, and the free-living nematodes Caenorhabditis elegans and Panagrellus redivivus, were placed on fungal colonies of M. drechsleri grown in Petri dishes. Within one day, none of the nematodes placed near adhesive knobs were motile. To determine where M. drechsleri fits within the existing phylogeny of nematode-trapping fungi, the ITS-1 and 2 regions of rDNA and the nuclear gene EF1-a were sequenced in this study for the new isolate of M. drechsleri, for M. parvicolle, and for isolates of M. lysipagum and M. ellipsosporum distinct from those in Genbank. Parsimony trees were constructed showing the closest molecular relative of M. drechsleri to be the newly sequenced isolate of M. ellipsosporum; the latter had a highly divergent sequence from the morphological isolate of M. ellipsosporum recorded in GenBank. Because unique, ever-present and discrete morphological characters are absent in these related taxa, an independent molecular character should be considered essential for their accurate and rapid identification.}
}
Matrix 2562 of Study 1237

Citation title:
"Morphological variability and molecular phylogeny of the nematophagous fungus Monacrosporium drechsleri".

This study was previously identified under the legacy study ID S1151
(Status: Published).
Matrices
Title: ITS
Description: Legacy TreeBASE Matrix ID = M2080
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Arthrobotrys haptospora |
(none)
|
GCGGAAGGATCATTACCAAAACAT-AGCTG |
| Dactylella formosana |
(none)
|
GCGGAAGG-TCATTACCAAT-CAG--GCTG |
| Monacrosporium drechsleri |
(none)
|
GCGGAAGGATCATTACCAAT-CAT---GTC |
| Monacrosporium ellipsosporum ATCC |
(none)
|
GCGGAAGGATCATTACCAAT-CAT---GTC |
| Monacrosporium ellipsosporum CBS |
(none)
|
GCGGAAGGATCATTACCAAAACTT-AGCTG |
| Monacrosporium leptosporum |
(none)
|
GCGGAAGGATCATTACCAAT-CAG--GCTG |
| Monacrosporium lysipagum |
(none)
|
GCGGAAGGATCATTACCAATTCAT---GTC |
| Monacrosporium mammillatum |
(none)
|
GCGGAAGGATCATTACCAAAA-TT-AGCTG |
| Monacrosporium parvicolle |
(none)
|
GCGGAAGGATCATTACCAAACAAAAAGTGA |
| Monacrosporium phymatopagum |
(none)
|
GCGGAAGGATCATTACCAAAACTT-AGCTG |
| Monacrosporium tentaculatum |
(none)
|
GCGGAAGGATCATTACCAAAACAATAGCTG |
Columns
None of the columns has a description.