@ARTICLE{TreeBASE2Ref20683,
author = {Guillermo P?rez and Bernard Slippers and Michael J Wingfield and Brenda D Wingfield and Angus Carnegie and Treena I. Burgess},
title = {Cryptic species, native populations and biological invasions by a eucalypt forest pathogen},
year = {2012},
keywords = {Mycosphaerella leaf disease, microsatellite, population genetics, STRUCTURE, forest pathogen, Eucalyptus, Teratosphaeria nubilosa},
doi = {},
url = {http://},
pmid = {},
journal = {Molecular Ecology},
volume = {},
number = {},
pages = {},
abstract = {Human associated introduction of pathogens and consequent invasions are very evident in areas where no related organisms existed before. In areas where related but distinct populations or closely related cryptic species already exist, the invasion process is much harder to unravel. In this study, the population structure of the Eucalyptus leaf pathogen Teratosphaeria nubilosa was studied within its native range in Australia, including both commercial plantations and native forests. A collection of 521 isolates from across its distribution was characterized using eight microsatellite loci, resulting in 112 multilocus haplotypes (MLH). Multivariate and Bayesian analyses of the population conducted in STRUCTURE revealed three genetically isolated groups (A, B and C), with no evidence for recombination or hybridization among groups, even when they co-occur in the same plantation. DNA sequence data of the ITS (n=32), ?-tubulin (n=32) and 27 anonymous loci (n=16) were consistent with microsatellite data in suggesting that T. nubilosa should be considered as a species complex, but could not distinguish groups A and C. Patterns of genetic diversity provided evidence of biological invasions by the pathogen within Australia in the states of Western Australia and New South Wales, and helped unravel the pattern of invasion beyond Australia into New Zealand, Brazil and Uruguay. No significant genetic differences in pathogen populations collected in native forests and commercial plantations were observed. This emphasizes the importance of sanitation in the acquisition of nursery stock for the establishment of commercial plantations.}
}
Matrix 12534 of Study 12689

Citation title:
"Cryptic species, native populations and biological invasions by a eucalypt forest pathogen".

Study name:
"Cryptic species, native populations and biological invasions by a eucalypt forest pathogen".

This study is part of submission 12689
(Status: Published).
Matrices
Title: TN3
Description: TN3 loci
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Teratosphaeria nubilosa CMW 3282 ex-epitype Victoria(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 26014 South Africa(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 26218 Uruguay(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30900 Brazil(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30714 NSW(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30752 Victoria(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30751 Victoria(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30715 NSW(Group C) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30707 NSW(Group A) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30709 NSW(Group A) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30717 NSW(Group A) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30735 Tasmania(Group B) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30723 WA(Group B) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30745 Victoria(Group B) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 30750 Vicoria(Group B) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Teratosphaeria nubilosa CMW 31008 New Zealand(Group B) |
(none)
|
GAGTCCCTTCACGTCTAAGCCATCTGACTT |
Columns
None of the columns has a description.