Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 12666 of Study 12698
Citation title: "Culture-free survey reveals diverse and distinctive fungal communities associated with developing figs (Ficus spp.) in Panama ".
Study name: "Culture-free survey reveals diverse and distinctive fungal communities associated with developing figs (Ficus spp.) in Panama ".
This study is part of submission 12698
(Status: Published).
Matrices
Title: Funal communities in Ficus flowers
Description: internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Cryptococcus victoriae AM160647 1 | (none) | AAGACGGGTCGTTTAAAGCCATTATGTCAA |
| Ficus triangle Early Seed 1 | (none) | -----------TTTAAAGCCATTATGTCAA |
| Cryptococcus tephrensis DQ000318 1 | (none) | --------TTGTTTAAAGCCATTATGTCAA |
| Ficus insipida Recep Seed 3 | (none) | --GACGGGTCGTTTAAAGCCATTCCACCAG |
| Ficus obtusifolia Early Seed 2 5 | (none) | AGGACGGGTCGTTTAAAGCCATTCCACCAG |
| Rhodotorula sp SY100 AB026010 2 | (none) | AAGACGGGTCGTTTAAAGCCATTCCACCAG |
| Rhodotorula mucilaginosa AB1931 | (none) | AAGACGGGTCGTTTAAAGCCATTCCACCAG |
| Rhodotorula glutinis FJ345357 1 | (none) | AAGACGGGTCGTTTAAAGTCATTACACCAG |
| Leucosporidium antarcticum AF444529 1 | (none) | ------------------------------ |
| Alternaria tenuissima AY154712 1 | (none) | ------------TTACAGCCATTACGCCAG |
| Ficus obtusifolia Recep Gall 1 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Bipolaris spicifera GU183125 1 | (none) | ------------------------------ |
| Ficus triangle Early Gall 6 3 | (none) | ------------------------------ |
| Phoma medicaginis EU167575 1 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Ficus obtusifolia Recep Gall 8 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Ficus insipida Recep Seed 1 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Ficus insipida Early Seed 3 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Ficus insipida Recep Gall 9 3 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Ficus popenoei Recep Gall 8 | (none) | AAGACGGGCCGCTTACAGCCATTACGCCAG |
| Ficus obtusifolia Recep Gall 5 | (none) | AAGACGGGCCGCTTACAACCATTACGCCAG |
| Coniozyma leucospermi EU552113 1 | (none) | AAGACGGGCCGCTTACAACCATTACGCCAG |
| Ficus obtusifolia Recep Gall 6 2 | (none) | AAGACGGGTCGCTTACAACCATTACGCCAG |
| Ficus obtusifolia Early Seed 4 2 | (none) | AAGACGGGCGGATTACAACCATTACGCCAG |
| Taphrina deformans DQ470973 1 | (none) | AAGACGGGTCGCTTAAGACCATTACGCCAG |
| Fusarium brachygibbosum GQ50545 | (none) | ------------------------------ |
| Ficus triangle Early Gall 14 | (none) | ------------------------------ |
| Ficus obtusifolia Recep Gall 2 2 | (none) | AAGACGGGTCATTGATGACCATTATGCCAG |
| Candida quercitrusa AM160627 1 | (none) | ------------------------------ |
| Debaryomyces hansenii FN667855 | (none) | ------------------------------ |
| Candida sp HA 1671 AM160629 1 | (none) | AAGACGGGCGGCTTAGGATCATTATGCCAG |
| Candida tropicalis FJ515227 1 | (none) | AAGACGGGCGACTTAAGATCATTATGCCAA |
| Lodderomyces elongisporus FJ515 | (none) | -AGACGGGCGACTTAAGATCATTATGCCAA |
| Pichia anomala isolate M10 FJ86 | (none) | AAGACGGGCGGCATTAGATCATTACGCCAG |
| Candida sp A564 HM364288 1 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus costaricana Late Gall 2 2 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus costaricana Late Seed 6 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus costaricana Late Gall 1 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus costaricana Late Gall 6 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus costaricana Late Seed 1 5 | (none) | ----------------------TAGGGC?G |
| Ficus popenoei Early Gall 11 4 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus popenoei Early Seed 11 2 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus popenoei Early Gall 2 2 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus popenoei Early Seed 10 3 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus obtusifolia Late Gall 12 8 | (none) | A----------------------------- |
| Pichia sp UFMG T05 200 1 EU5801 | (none) | ------------------------------ |
| Williopsis saturnus FN868262 1 | (none) | ------------------------------ |
| Ficus triangle Late Gall 10 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus triangle Late Seed 5 2 | (none) | ---------GATATTAGATCATTACGCCAG |
| Ogataea cecidiorum FJ897742 1 | (none) | ------------------------------ |
| Ficus insipida Early Seed 1 2 | (none) | AAGACGGGCGGCATATAACCATTATGCCAG |
| Ficus insipida Early Seed 8 3 | (none) | AAGACGGGCGGCATATAACCATTATGCCAG |
| Ficus maxima Early Seed 1 | (none) | AAGACGGGCGGCATATAACCATTATGCCAG |
| Ficus obtusifolia Early Seed 3 | (none) | --GACGGGCGGCATATAACCATTATGCCAG |
| Ficus obtusifolia Late Seed 8 | (none) | --------------------------GCTG |
| Saccharomyces cerevisiae EU6496 | (none) | ------------------------------ |
| Ficus insipida Recep Gall 10 | (none) | ------------------------------ |
| Schizosaccharomyces pombe Z1913 | (none) | AAGACGGGCCATTGAAAACCATTATGTCAG |
| Candida akabanensis strain CBS | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Candida sp 1A EF565862 1 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Candida flosculorum EF137918 1 | (none) | ------------------------------ |
| Clavispora lusitaniae AY174089 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Candida oregonensis FN667841 1 | (none) | ------------------------------ |
| Candida sp C107DX Y2 FJ865Ficus obt | (none) | ------------------------------ |
| Ficus triangle Late Gall 6 | (none) | AAGACGGGCGATATTAGATCATTACGCCAG |
| Ficus costaricana Late Gall 3 3 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus costaricana Late Seed 13 4 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus costaricana Late Seed 8 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Recep Seed 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus insipida Recep Gall 11 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus insipida Early Gall 3 10 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus insipida Recep Seed 7 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus popenoei Recep Gall 4 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus popenoei Recep Seed 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus insipida Late Seed 2 3 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus insipida Recep Gall 7 6 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus obtusifolia Early Seed 12 5 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Early Gall 16 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus maxima Recep Seed 8 6 | (none) | AAGACGGGCGGCTTGCAACCATTACG-CAG |
| Ficus obtusifolia Late Seed 2 3 | (none) | AAGACGGGCGGCTTGCGACCATTACGCCAG |
| Ficus maxima Recep Gall 6 5 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Recep Seed 1 4 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus popenoei Recep Gall 5 5 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus popenoei Recep Seed 4 3 | (none) | AAGACGGGCGGCCTGCAACCATTACGCCAG |
| Ficus triangle Early Gall 4 3 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus costaricana Late Seed 9 | (none) | -------------TGCAACCATCACGCCAG |
| Ficus insipida Early Seed 6 | (none) | ------------------------------ |
| Ficus maxima Recep Seed 1 | (none) | ------------------------------ |
| Ficus insipida Recep Gall 6 | (none) | ------------------------------ |
| Ficus maxima Recep Gall 5 | (none) | ------------------------------ |
| Ficus popenoei Early Seed 6 | (none) | ------------------------------ |
| Ficus obtusifolia Late Seed 1 3 | (none) | ----------------------------CA |
| Ficus insipida Early Seed 2 | (none) | -----------------------------G |
| Ficus obtusifolia Late Gall 15 8 | (none) | ---------------------------CAG |
| Ficus maxima Recep Gall 3 2 | (none) | ------------------------------ |
| Ficus triangle Ripe Gall 1 11 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Late Gall 3 4 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Late Gall 8 4 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Early Gall 15 6 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Late Seed 8 4 | (none) | ---ACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Early Seed 3 11 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus popenoei Recep Gall 1 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus triangle Early Gall 12 | (none) | ------------------------------ |
| Ficus triangle Late Seed 1 | (none) | ------------------------------ |
| Ficus triangle Late Gall 1 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus maxima Recep Gall 1 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCAG |
| Ficus maxima Recep Seed 6 | (none) | ------------------------------ |
| Candida gelsemii DQ988045 1 | (none) | ------------------------------ |
| Metschnikowia bicuspidata EU809 | (none) | ------------------------------ |
| Metschnikowia sp XY103 DQ367881 | (none) | -------GCGACTTGCAACCATTACGCCAG |
| Metschnikowia sp XY201 DQ367882 | (none) | -------GCGACTTGCAACCATTACGCCAG |
| Unidentified Metschnikowia AM16 | (none) | ------------------------------ |
| Candida picachoensis strain ATC | (none) | ------------TTGCAACCATTACGCCAG |
| Metschnikowia agaves HMF | (none) | ------------------------------ |
| Candida picinguabensis DQ377638 | (none) | ------------------------------ |
| Ficus insipida Late Gall 11 8 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCGG |
| Ficus insipida Late Seed 4 7 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCGG |
| Ficus insipida Recep Seed 5 3 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCGG |
| Ficus insipida Late Gall 1 4 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCGG |
| Ficus insipida Late Seed 5 2 | (none) | AAGACGGGCGGCTTGCAACCATTACGCCGG |
Columns
None of the columns has a description.
