@ARTICLE{TreeBASE2Ref20763,
author = {yu ito and tetsuo ohi-toma and norio tanaka},
title = {Comprehensive phylogenetic analyses of the Ruppia maritima complex focusing on taxa from the Mediterranean},
year = {2013},
keywords = {hybridization, ITS, phyB, phylogeny, psbA-trnH, rbcL, Ruppia},
doi = {},
url = {http://},
pmid = {},
journal = {Journal of Plant Research},
volume = {},
number = {},
pages = {},
abstract = {Recent molecular phylogenetic studies reported high diversity of Ruppia species in the Mediterranean.
Multiple taxa, including apparent endemics, are known from that region, however, they have thus far not been
exposed to phylogenetic analyses aimed at studying their relationships to taxa from other parts of the world.
Here we present a comprehensive phylogenetic analyses of the R. maritima complex using data sets composed
of DNA sequences of the plastid genome, the multi-copy nuclear ITS region, and the low-copy nuclear
phyB gene with a primary focus on the Mediterranean representatives of the complex. As a result, a new
lineage, ?Drepanensis?, was identified as the seventh entity of the complex. This lineage is endemic to the
Mediterranean. The accessions included in the former ?Tetraploid? entity were reclassified into two entities:
an Asia?Australia?Europe disjunct ?Tetraploid_?? with a paternal ?Diploid? origin, and a European
?Tetraploid_?? originating from a maternal ?Drepanensis? lineage. Another entity, ?Tetraploid_??, is likely
to have been originated as a result of chloroplast capture through backcrossing hybridization between paternal
?Tetraploid_?? and maternal ?Tetraploid_??. Additional discovery of multiple tetraploidizations as well as
hybridization and chloroplast capture at the tetraploid level indicated that hybridization has been a significant
factor in the diversification of Ruppia.}
}
Matrix 13192 of Study 12786

Citation title:
"Comprehensive phylogenetic analyses of the Ruppia maritima complex focusing on taxa from the Mediterranean".

Study name:
"Comprehensive phylogenetic analyses of the Ruppia maritima complex focusing on taxa from the Mediterranean".

This study is part of submission 12786
(Status: Published).
Matrices
Title: Ruppia maritima ITS BI
Description: Ruppia maritima ITS BI
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Ruppia cirrhosa B |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
| Ruppia maritima B |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
| Ruppia maritima D |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
| Ruppia maritima F |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
| Ruppia maritima E |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
| Ruppia maritima B''' |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
| Ruppia maritima E' |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Columns
None of the columns has a description.