@ARTICLE{TreeBASE2Ref17038,
author = {Jeffrey L. Peters and Kevin G. McCracken and Yuri N. Zhuravlev and Yi Lu and Robert E. Wilson and Kevin P. Johnson and Kevin E. Omland},
title = {Phylogenetics of wigeons and allies (Anatidae: Anas): the importance of sampling multiple loci and multiple individuals},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Species-level DNA phylogenies frequently suffer from two shortcomings gene trees usually are constructed from a single locus, and often species are represented by only one individual. To evaluate the effect of these two shortcomings, we tested phylogenetic hypotheses within the wigeons and allies, a clade of Anas ducks (Anatidae) composed of five species. We sequenced two nuclear introns from the Z-chromosome-linked chromo-helicase binding protein gene (CHD1Zb and CHD1Za) and the mitochondrial DNA (mtDNA) control region for multiple individuals sampled from widespread geographic locations. We compared these phylogenies to previously published phylogenies constructed from morphology and protein coding regions of mtDNA. Relative to other nuclear introns, CHD showed remarkable phylogenetic utility. Of the 26 CHD1Zb alleles identified, only one was shared between two species, and the combined CHD datasets revealed that four of the five species were consistent with monophyly. Several species shared mtDNA haplotypes, which probably was a result of interspecific hybridization. Overall, the nuclear CHD tree and the mtDNA tree were more congruent with coding regions of mtDNA than they were with morphology.}
}
Matrix 1335 of Study 1309

Citation title:
"Phylogenetics of wigeons and allies (Anatidae: Anas): the importance of sampling multiple loci and multiple individuals".

This study was previously identified under the legacy study ID S1229
(Status: Published).
Matrices
Title: mtDNA control region domains I, II, & III
Description: Legacy TreeBASE Matrix ID = M2138
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Anas strepera |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Anas sibilatrix |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Anas platyrhyncos |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Anas penelope |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Anas falcata |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Anas crecca |
(none)
|
CATACATTTATATTCCCCATATATTTACCT |
Anas americana |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Anas acuta |
(none)
|
CATACATTTATATTCCCCATATATTAACCT |
Columns
None of the columns has a description.