@ARTICLE{TreeBASE2Ref21301,
author = {Lucas Charles Majure and RAUL PUENTE and M. Patrick Griffith and Douglas E. Soltis and Walter S. Judd},
title = {Opuntia lilae, another Tacinga hidden in Opuntia s.l. (Cactaceae)},
year = {2012},
keywords = {biogeography, Caatinga, Caribbean, Opuntia, Tacinga},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Phylogenetic analyses based on molecular data revealed that the Venezuelan endemic, Opuntia lilae, considered a species of Opuntia s.s. since its description, actually represents a species of the mostly Brazilian clade, Tacinga. Through ancestral state reconstruction, we also identify morphological synapomorphies of the Tacinga clade, which further support the relationship of Tacinga and Opuntia lilae. We herein transfer Opuntia lilae to the genus Tacinga, making the combination, Tacinga lilae (Trujillo & Ponce) Majure & R. Puente. The existence of a species of Tacinga in northeastern Venezuela suggests that members of the Tacinga clade may have previously been more widespread than their current distribution suggests or that members of the Tacinga clade may have been dispersed long distance from the Caatinga of Brazil, where Tacinga most likely originated. This study illustrates that assumptions regarding regional floristic assemblages should be verified with detailed systematic studies at the clade and species levels. }
}
Matrix 14183 of Study 13323

Citation title:
"Opuntia lilae, another Tacinga hidden in Opuntia s.l. (Cactaceae)".

Study name:
"Opuntia lilae, another Tacinga hidden in Opuntia s.l. (Cactaceae)".

This study is part of submission 13323
(Status: Published).
Matrices
Title: Tacinga lilae DNA Matrix
Description: Tacinga lilae
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Brasiliopuntia brasiliensis DBG 0559 |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Miqueliopuntia miquelii DBG 0129 |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Opuntia arechavalatae |
(none)
|
------------------------------ |
Opuntia lilae 0369 |
(none)
|
GGAGTGA-GGGTATGATCCATGCATATTGG |
Opuntia macbridei HBG |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Opuntia quimilo 0111 |
(none)
|
------------------------------ |
Opuntia schickendantzii 2010 |
(none)
|
-------AGGGTATGATCCATGCATATTGG |
Tacinga funalis AY042660.1 |
(none)
|
------------------------------ |
Tacinga inamoena LCM 3849 |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Tacinga inamoena DBG 0017 |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Tacinga palmadora DBG 0392 |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Tacinga saxatilis |
(none)
|
------------------------------ |
Tunilla corrugata 0006 |
(none)
|
------------------------------ |
Salmiopuntia salmiana HBG 18366 |
(none)
|
GGAGTGAAGGGTATGATCCATGCATATTGG |
Columns
None of the columns has a description.