Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 15513 of Study 1550
Citation title: "Phylogeny and biogeography of Isoetes (Isoetaceae) based on nuclear and chloroplast DNA sequence data".
This study was previously identified under the legacy study ID S1495
(Status: Published).
Matrices
Title: part E
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Abutilon theophrasti | (none) | ------------------------------ |
| Aceras anthropophorum | (none) | ------------------------------ |
| Acer pseudoplatanus | (none) | ------------------------------ |
| Achillea millefolium | (none) | ------------------------------ |
| Aconitum apoiense | (none) | ------------------------------ |
| Acorus calamus | (none) | ------------------------------ |
| Actaea spicata | (none) | ------------------------------ |
| Adoxa moschatellina | (none) | ------------------------------ |
| Aegopodium podagraria | (none) | ------------------------------ |
| Aesculus parviflora | (none) | ------------------------------ |
| Aethusa cynapium | (none) | ------------------------------ |
| Agrimonia eupatoria | (none) | ------------------------------ |
| Agrostemma githago | (none) | ------------------------------ |
| Agrostis stolonifera | (none) | ------------------------------ |
| Ailanthus altissima | (none) | ------------------------------ |
| Aira caryophyllea | (none) | ------------------------------ |
| Ajuga decumbens | (none) | ------------------------------ |
| Alchemilla mollis | (none) | ------------------------------ |
| Alisma plantago-aquatica | (none) | ------------------------------ |
| Alliaria petiolata | (none) | ------------------------------ |
| Allium cepa | (none) | ------------------------------ |
| Alnus incana | (none) | ------------------------------ |
| Alopecurus pratensis | (none) | ------------------------------ |
| Althaea officinalis | (none) | ------------------------------ |
| Alyssum canescens | (none) | ------------------------------ |
| Amaranthus paniculatus | (none) | ------------------------------ |
| Amborella trichopoda | (none) | ------------------------------ |
| Ambrosia artemisiifolia | (none) | ------------------------------ |
| Amelanchier bartramiana | (none) | ------------------------------ |
| Ammophila breviligulata | (none) | ------------------------------ |
| Anacamptis pyramidalis | (none) | ------------------------------ |
| Anagallis arvensis | (none) | ------------------------------ |
| Anchusa capensis | (none) | ------------------------------ |
| Anchusa officinalis | (none) | ------------------------------ |
| Andromeda polifolia | (none) | ------------------------------ |
| Anemone cernua | (none) | ------------------------------ |
| Angelica archangelica | (none) | ------------------------------ |
| Anisantha sterilis | (none) | ------------------------------ |
| Antennaria luzuloides | (none) | ------------------------------ |
| Anthemis arvensis | (none) | ------------------------------ |
| Anthericum liliago | (none) | ------------------------------ |
| Anthoxanthum odoratum | (none) | ------------------------------ |
| Anthriscus cerefolium | (none) | ------------------------------ |
| Anthyllis vulneraria | (none) | ------------------------------ |
| Antirrhinum majus | (none) | ------------------------------ |
| Apera interrupta | (none) | ------------------------------ |
| Aphanes arvensis | (none) | ------------------------------ |
| Apium graveolens | (none) | ------------------------------ |
| Aquilegia ecalcarata | (none) | ------------------------------ |
| Aquilegia vulgaris | (none) | ------------------------------ |
| Arabidopsis thaliana | (none) | ------------------------------ |
| Arabis glabra | (none) | ------------------------------ |
| Arabis hirsuta | (none) | ------------------------------ |
| Arctium lappa | (none) | ------------------------------ |
| Arctostaphylos alpina | (none) | ------------------------------ |
| Arctostaphylos uva-ursi | (none) | ------------------------------ |
| Arenaria drummondii | (none) | ------------------------------ |
| Aristolochia kaempferi | (none) | ------------------------------ |
| Armeria bottendorfensis | (none) | ------------------------------ |
| Armoracia rusticana | (none) | ------------------------------ |
| Arnica montana | (none) | ------------------------------ |
| Arnoseris minima | (none) | ------------------------------ |
| Aronia sp | (none) | ------------------------------ |
| Arrhenatherum elatius | (none) | ------------------------------ |
| Artemisia vulgaris | (none) | ------------------------------ |
| Arum italicum | (none) | ------------------------------ |
| Arum maculatum | (none) | ------------------------------ |
| Asparagus officinalis | (none) | ------------------------------ |
| Asperula laevigata | (none) | ------------------------------ |
| Aster bakeranus | (none) | ------------------------------ |
| Aster novae-angliae | (none) | ------------------------------ |
| Astragalus membranaceus | (none) | ------------------------------ |
| Atriplex patula | (none) | ------------------------------ |
| Avena sativa | (none) | ------------------------------ |
| Axyris prostrata | (none) | ------------------------------ |
| Ballota hispanica | (none) | ------------------------------ |
| Barbarea vulgaris | (none) | ------------------------------ |
| Bellis perennis | (none) | ------------------------------ |
| Berberis thunbergii | (none) | ------------------------------ |
| Berteroa incana | (none) | ------------------------------ |
| Berula erecta | (none) | ------------------------------ |
| Beta vulgaris | (none) | ------------------------------ |
| Betula platyphylla | (none) | ------------------------------ |
| Bidens cernua | (none) | ------------------------------ |
| Blackstonia imperfoliata | (none) | ------------------------------ |
| Blysmus compressus | (none) | ------------------------------ |
| Brachypodium pinnatum | (none) | ------------------------------ |
| Brassica napus | (none) | ------------------------------ |
| Briza media | (none) | ------------------------------ |
| Bromopsis erecta | (none) | ------------------------------ |
| Bromus hordeaceus | (none) | ------------------------------ |
| Bryonia dioica | (none) | ------------------------------ |
| Buddleja davidii | (none) | ------------------------------ |
| Bunias orientalis | (none) | ------------------------------ |
| Bunium bulbocastanum | (none) | ------------------------------ |
| Bupleurum fruticosum | (none) | ------------------------------ |
| Bupleurum rotundifolium | (none) | ------------------------------ |
| Bupleurum tenuissimum | (none) | ------------------------------ |
| Butomus umbellatus | (none) | ------------------------------ |
| Buxus sempervirens | (none) | ------------------------------ |
| Cakile maritima | (none) | ------------------------------ |
| Calamagrostis epigeios | (none) | ------------------------------ |
| Calammophila baltica | (none) | ------------------------------ |
| Calendula officinalis | (none) | ------------------------------ |
| Calla palustris | (none) | ------------------------------ |
| Callitriche hamulata | (none) | ------------------------------ |
| Callitriche hermaphroditica | (none) | ------------------------------ |
| Callitriche palustris | (none) | ------------------------------ |
| Callitriche platycarpa | (none) | ------------------------------ |
| Callitriche stagnalis | (none) | ------------------------------ |
| Calluna vulgaris | (none) | ------------------------------ |
| Caltha palustris | (none) | ------------------------------ |
| Calystegia sepium | (none) | GTTGGATTCAAAGCTGGTGTAAAAGACTAC |
| Campanula trachelium | (none) | ------------------------------ |
| Capsella bursa-pastoris | (none) | ------------------------------ |
| Cardamine amara | (none) | ------------------------------ |
| Carduus carlinoides | (none) | ------------------------------ |
| Carex hostiana | (none) | ------------------------------ |
| Carlina vulgaris | (none) | ------------------------------ |
| Carpinus betulus | (none) | ------------------------------ |
| Carum carvi | (none) | ------------------------------ |
| Castanea sativa | (none) | ------------------------------ |
| Catabrosa aquatica | (none) | ------------------------------ |
| Caucalis platycarpos | (none) | ------------------------------ |
| Centaurea cyanus | (none) | ------------------------------ |
| Centaurea melitensis | (none) | ------------------------------ |
| Centaurium erythraea | (none) | ------------------------------ |
| Cephalanthera damasonium | (none) | ------------------------------ |
| Cerastium glomeratum | (none) | ------------------------------ |
| Ceratochloa carinata | (none) | ------------------------------ |
| Ceratophyllum demersum | (none) | ------------------------------ |
| Ceratophyllum submersum | (none) | ------------------------------ |
| Chaenorhinum origanifolium | (none) | ------------------------------ |
| Chaerophyllum temulum | (none) | ------------------------------ |
| Chamerion angustifolium | (none) | ------------------------------ |
| Chelidonium majus | (none) | ------------------------------ |
| Chenopodium foliosum | (none) | ------------------------------ |
| Chrysanthemum segetum | (none) | ------------------------------ |
| Chrysosplenium album | (none) | ------------------------------ |
| Chrysosplenium alternifolium | (none) | ------------------------------ |
| Chrysosplenium iowense | (none) | ------------------------------ |
| Cichorium intybus | (none) | ------------------------------ |
| Cicuta virosa | (none) | ------------------------------ |
| Circaea alpina | (none) | ------------------------------ |
| Circaea lutetiana | (none) | ------------------------------ |
| Cirsium arvense | (none) | ------------------------------ |
| Cirsium palustre | (none) | ------------------------------ |
| Cladium mariscus | (none) | ------------------------------ |
| Claytonia perfoliata | (none) | ------------------------------ |
| Clematis vitalba | (none) | ------------------------------ |
| Clinopodium vulgare | (none) | ------------------------------ |
| Cochlearia danica | (none) | ------------------------------ |
| Coeloglossum viride | (none) | ------------------------------ |
| Coincya monensis | (none) | ------------------------------ |
| Colchicum speciosum | (none) | ------------------------------ |
| Conium maculatum | (none) | ------------------------------ |
| Conringia orientalis | (none) | ------------------------------ |
| Consolida ajacis | (none) | ------------------------------ |
| Convallaria majalis | (none) | ------------------------------ |
| Convolvulus arvensis | (none) | ------------------------------ |
| Conyza canadensis | (none) | ------------------------------ |
| Corispermum filifolium | (none) | ------------------------------ |
| Cornus mas | (none) | ------------------------------ |
| Cornus sanguinea | (none) | ------------------------------ |
| Cornus suecica | (none) | ------------------------------ |
| Coronopus squamatus | (none) | ------------------------------ |
| Corrigiola litoralis | (none) | ------------------------------ |
| Corydalis solida | (none) | ------------------------------ |
| Corylus avellana | (none) | ------------------------------ |
| Corynephorus canescens | (none) | ------------------------------ |
| Cotoneaster lacteus | (none) | ------------------------------ |
| Cotula coronopifolia | (none) | ------------------------------ |
| Crambe maritima | (none) | ------------------------------ |
| Crataegus columbiana | (none) | ------------------------------ |
| Crataegus monogyna | (none) | ------------------------------ |
| Crepis capillaris | (none) | ------------------------------ |
| Crithmum maritimum | (none) | ------------------------------ |
| Crocus pulchellus | (none) | ------------------------------ |
| Cruciata glabra | (none) | ------------------------------ |
| Cucubalus baccifer | (none) | ------------------------------ |
| Cuscuta epithymum | (none) | ------------------------------ |
| Cuscuta europaea | (none) | ------------------------------ |
| Cuscuta lupuliformis | (none) | ------------------------------ |
| Cicendia filiformis | (none) | ------------------------------ |
| Cymbalaria muralis | (none) | ------------------------------ |
| Cynodon dactylon | (none) | ------------------------------ |
| Cynoglossum officinale | (none) | ------------------------------ |
| Cynoglossum sp | (none) | ------------------------------ |
| Cynosurus cristatus | (none) | ------------------------------ |
| Cyperus laevigatus | (none) | ------------------------------ |
| Cyperus pulchellus | (none) | ------------------------------ |
| Cytisus scoparius | (none) | ------------------------------ |
| Dactylis glomerata | (none) | ------------------------------ |
| Dactylorhiza maculata | (none) | ------------------------------ |
| Danthonia spicata | (none) | ------------------------------ |
| Daphne mezereum | (none) | ------------------------------ |
| Datura stramonium | (none) | GTTGGATTCAAAGCTGGTGTTAAAGAGTAC |
| Daucus carota | (none) | ------------------------------ |
| Deschampsia cespitosa | (none) | ------------------------------ |
| Descurainia sophia | (none) | ------------------------------ |
| Desmazeria rigida | (none) | ------------------------------ |
| Dianthus carthusianorum | (none) | ------------------------------ |
| Digitalis purpurea | (none) | ------------------------------ |
| Digitaria sanguinalis | (none) | ------------------------------ |
| Diplotaxis tenuifolia | (none) | ------------------------------ |
| Dipsacus pilosus | (none) | ------------------------------ |
| Dipsacus sativus | (none) | ------------------------------ |
| Doronicum pardalianches | (none) | ------------------------------ |
| Draba muralis | (none) | ------------------------------ |
| Drosera intermedia | (none) | ------------------------------ |
| Drosera rotundifolia | (none) | ------------------------------ |
| Echinochloa crus-galli | (none) | ------------------------------ |
| Echinodorus cordifolius | (none) | ------------------------------ |
| Echium vulgare | (none) | ------------------------------ |
| Egeria densa | (none) | ------------------------------ |
| Elaeagnus umbellata | (none) | ------------------------------ |
| Elatine triandra | (none) | ------------------------------ |
| Eleocharis quinqueflora | (none) | ------------------------------ |
| Elymus sibiricus | (none) | ------------------------------ |
| Elodea nuttallii | (none) | ------------------------------ |
| Elytrigia repens | (none) | ------------------------------ |
| Empetrum nigrum | (none) | ------------------------------ |
| Epilobium rigidum | (none) | ------------------------------ |
| Epipactis helleborine | (none) | ------------------------------ |
| Eragrostis minor | (none) | ------------------------------ |
| Eranthis hyemalis | (none) | ------------------------------ |
| Erica cinerea | (none) | ------------------------------ |
| Erica tetralix | (none) | ------------------------------ |
| Erigeron annuus | (none) | ------------------------------ |
| Eriophorum angustifolium | (none) | ------------------------------ |
| Erodium cicutarium | (none) | ------------------------------ |
| Erophila verna | (none) | ------------------------------ |
| Erucastrum gallicum | (none) | ------------------------------ |
| Eryngium campestre | (none) | ------------------------------ |
| Eryngium giganteum | (none) | ------------------------------ |
| Eryngium maritimum | (none) | ------------------------------ |
| Erysimum cheiri | (none) | ------------------------------ |
| Eschscholzia californica | (none) | ------------------------------ |
| Euonymus alatus | (none) | ------------------------------ |
| Eupatorium cannabinum | (none) | ------------------------------ |
| Euphorbia amygdaloides | (none) | ------------------------------ |
| Euphorbia cyparissias | (none) | ------------------------------ |
| Euphorbia esula | (none) | ------------------------------ |
| Euphorbia helioscopia | (none) | ------------------------------ |
| Euphorbia milii | (none) | ------------------------------ |
| Euphorbia peplus | (none) | ------------------------------ |
| Euphorbia polychroma | (none) | ------------------------------ |
| Euphorbia stricta | (none) | ------------------------------ |
| Euphorbia tithymaloides | (none) | ------------------------------ |
| Euphrasia rostkoviana | (none) | ------------------------------ |
| Fagopyrum esculentum | (none) | ------------------------------ |
| Fagus sylvatica | (none) | ------------------------------ |
| Fallopia scandens | (none) | ------------------------------ |
| Festuca rubra | (none) | ------------------------------ |
| Festulolium holmbergii | (none) | ------------------------------ |
| Ficus pumila | (none) | ------------------------------ |
| Filago pyramidata | (none) | ------------------------------ |
| Filipendula vulgaris | (none) | ------------------------------ |
| Fragaria vesca | (none) | ------------------------------ |
| Frangula alnus | (none) | ------------------------------ |
| Fraxinus chinensis | (none) | ------------------------------ |
| Fritillaria meleagris | (none) | ------------------------------ |
| Fumaria officinalis | (none) | ------------------------------ |
| Gagea lutea | (none) | ------------------------------ |
| Galanthus nivalis | (none) | ------------------------------ |
| Galeopsis angustifolia | (none) | ------------------------------ |
| Galinsoga parviflora | (none) | ------------------------------ |
| Galium mollugo | (none) | ------------------------------ |
| Genista anglica | (none) | ------------------------------ |
| Gentiana cruciata | (none) | ------------------------------ |
| Gentiana procera | (none) | ------------------------------ |
| Gentianella amarella | (none) | ------------------------------ |
| Gentianella rapunculoides | (none) | ------------------------------ |
| Geranium grandiflorum | (none) | ------------------------------ |
| Geum rivale | (none) | ------------------------------ |
| Glaucium flavum | (none) | ------------------------------ |
| Glaux maritima | (none) | ------------------------------ |
| Glechoma hederacea | (none) | ------------------------------ |
| Glyceria fluitans | (none) | ------------------------------ |
| Glycine max | (none) | ------------------------------ |
| Gnaphalium luteoalbum | (none) | ------------------------------ |
| Goodyera pubescens | (none) | ------------------------------ |
| Goodyera repens | (none) | ------------------------------ |
| Gratiola brevifolia | (none) | ------------------------------ |
| Groenlandia densa | (none) | ------------------------------ |
| Gymnadenia conopsea | (none) | ------------------------------ |
| Hedera helix | (none) | ------------------------------ |
| Helianthemum grandiflorum | (none) | ------------------------------ |
| Helianthus annuus | (none) | ------------------------------ |
| Helictotrichon requienii | (none) | ------------------------------ |
| Helleborus viridis | (none) | ------------------------------ |
| Heracleum mantegazzianum | (none) | ------------------------------ |
| Herminium monorchis | (none) | ------------------------------ |
| Herniaria glabra | (none) | ------------------------------ |
| Hesperis matronalis | (none) | ------------------------------ |
| Hieracium lactucella | (none) | ------------------------------ |
| Hierochloe odorata | (none) | ------------------------------ |
| Hippocrepis comosa | (none) | ------------------------------ |
| Hippophae salicifolia | (none) | ------------------------------ |
| Hippuris vulgaris | (none) | ------------------------------ |
| Holcus lanatus | (none) | ------------------------------ |
| Holosteum umbellatum | (none) | ------------------------------ |
| Honckenya peploides | (none) | ------------------------------ |
| Hordeum vulgare | (none) | ------------------------------ |
| Hottonia palustris | (none) | ------------------------------ |
| Humulus lupulus | (none) | ------------------------------ |
| Hydrocharis morsus-ranae | (none) | ------------------------------ |
| Hydrocotyle vulgaris | (none) | ------------------------------ |
| Hyoscyamus niger | (none) | TAGGTCGATTTTGTTGGAAAATCCAGGTTA |
| Hypericum perforatum | (none) | ------------------------------ |
| Hypochaeris radicata | (none) | ------------------------------ |
| Iberis amara | (none) | ------------------------------ |
| Ilex repanda | (none) | ------------------------------ |
| Illecebrum verticillatum | (none) | ------------------------------ |
| Impatiens capensis | (none) | ------------------------------ |
| Impatiens glandulifera | (none) | ------------------------------ |
| Impatiens noli tangere | (none) | ------------------------------ |
| Impatiens parviflora | (none) | ------------------------------ |
| Inula britannica | (none) | ------------------------------ |
| Iris germanica | (none) | ------------------------------ |
| Isatis tinctoria | (none) | ------------------------------ |
| Isolepis setacea | (none) | ------------------------------ |
| Iva frutescens | (none) | ------------------------------ |
| Jasione montana | (none) | ------------------------------ |
| Juglans nigra | (none) | ------------------------------ |
| Juncus alpinoarticulatus | (none) | ------------------------------ |
| Juncus articulatus | (none) | ------------------------------ |
| Juncus balticus | (none) | ------------------------------ |
| Juncus bufonius | (none) | ------------------------------ |
| Juncus bulbosus | (none) | ------------------------------ |
| Juncus capitatus | (none) | ------------------------------ |
| Juncus compressus | (none) | ------------------------------ |
| Juncus conglomeratus | (none) | ------------------------------ |
| Juncus effusus | (none) | ------------------------------ |
| Juncus filiformis | (none) | ------------------------------ |
| Juncus gerardii | (none) | ------------------------------ |
| Juncus inflexus | (none) | ------------------------------ |
| Juncus maritimus | (none) | ------------------------------ |
| Juncus squarrosus | (none) | ------------------------------ |
| Juncus subnodulosus | (none) | ------------------------------ |
| Kickxia elatine | (none) | ------------------------------ |
| Knautia arvensis | (none) | ------------------------------ |
| Koeleria pyramidata | (none) | ------------------------------ |
| Laburnum anagyroides | (none) | ------------------------------ |
| Lactuca serriola | (none) | ------------------------------ |
| Lamiastrum galeobdolon | (none) | ------------------------------ |
| Lamium amplexicaule | (none) | ------------------------------ |
| Lamium purpureum | (none) | ------------------------------ |
| Lappula squarrosa | (none) | ------------------------------ |
| Lapsana communis | (none) | ------------------------------ |
| Lathyrus palustris | (none) | ------------------------------ |
| Leersia oryzoides | (none) | ------------------------------ |
| Legousia hybrida | (none) | ------------------------------ |
| Lemna gibba | (none) | ------------------------------ |
| Lemna minor | (none) | ------------------------------ |
| Lemna minuta | (none) | ------------------------------ |
| Lemna trisulca | (none) | ------------------------------ |
| Leontodon hispidus | (none) | ------------------------------ |
| Leontodon saxatilis | (none) | ------------------------------ |
| Leonurus sibiricus | (none) | ------------------------------ |
| Lepidium draba | (none) | ------------------------------ |
| Leucanthemum vulgare | (none) | ------------------------------ |
| Leucojum aestivum | (none) | ------------------------------ |
| Leymus chinensis | (none) | ------------------------------ |
| Ligustrum vulgare | (none) | ------------------------------ |
| Lilium martagon | (none) | ------------------------------ |
| Lilium superbum | (none) | ------------------------------ |
| Limonium vulgare | (none) | ------------------------------ |
| Limosella aquatica | (none) | ------------------------------ |
| Linaria vulgaris | (none) | ------------------------------ |
| Linnaea borealis | (none) | ------------------------------ |
| Linum perenne | (none) | ------------------------------ |
| Liparis loeselii | (none) | ------------------------------ |
| Listera smallii | (none) | ------------------------------ |
| Lithospermum officinale | (none) | ------------------------------ |
| Lithospermum sp | (none) | ------------------------------ |
| Littorella uniflora | (none) | ------------------------------ |
| Lobelia dortmanna | (none) | ------------------------------ |
| Lobularia maritima | (none) | ------------------------------ |
| Lolium perenne | (none) | ------------------------------ |
| Lonicera orientalis | (none) | ------------------------------ |
| Lonicera periclymenum | (none) | ------------------------------ |
| Lonicera prolifera | (none) | ------------------------------ |
| Lonicera xylosteum | (none) | ------------------------------ |
| Lotus corniculatus | (none) | ------------------------------ |
| Ludwigia palustris | (none) | ------------------------------ |
| Lunaria annua | (none) | ------------------------------ |
| Lupinus luteus | (none) | ------------------------------ |
| Luronium natans | (none) | ------------------------------ |
| Luzula campestris | (none) | ------------------------------ |
| Luzula luzuloides | (none) | ------------------------------ |
| Luzula multiflora | (none) | ------------------------------ |
| Luzula pilosa | (none) | ------------------------------ |
| Luzula sylvatica | (none) | ------------------------------ |
| Lychnis flos-cuculi | (none) | ------------------------------ |
| Lycium barbarum | (none) | GTTGGATTCAAAGCTGGTGTTAAAGAGTAC |
| Lycopus europaeus | (none) | ------------------------------ |
| Lysimachia vulgaris | (none) | ------------------------------ |
| Lythrum salicaria | (none) | ------------------------------ |
| Mahonia bealei | (none) | ------------------------------ |
| Mahonia japonica | (none) | ------------------------------ |
| Maianthemum dilatatum | (none) | ------------------------------ |
| Malaxis spicata | (none) | ------------------------------ |
| Malus sylvestris | (none) | ------------------------------ |
| Malva neglecta | (none) | ------------------------------ |
| Malva sylvestris | (none) | ------------------------------ |
| Marrubium vulgare | (none) | ------------------------------ |
| Matricaria recutita | (none) | ------------------------------ |
| Medicago sativa | (none) | ------------------------------ |
| Melampyrum arvense | (none) | ------------------------------ |
| Melampyrum lineare | (none) | ------------------------------ |
| Melampyrum pratense | (none) | ------------------------------ |
| Melica uniflora | (none) | ------------------------------ |
| Melilotus officinalis | (none) | ------------------------------ |
| Mentha arvensis | (none) | ------------------------------ |
| Menyanthes trifoliata | (none) | ------------------------------ |
| Mercurialis perennis | (none) | ------------------------------ |
| Mespilus germanica | (none) | ------------------------------ |
| Mibora minima | (none) | ------------------------------ |
| Milium effusum | (none) | ------------------------------ |
| Mimulus aurantiacus | (none) | ------------------------------ |
| Mimulus moschatus | (none) | ------------------------------ |
| Minuartia laricifolia | (none) | ------------------------------ |
| Misopates orontium | (none) | ------------------------------ |
| Moehringia trinervia | (none) | ------------------------------ |
| Moenchia erecta | (none) | ------------------------------ |
| Molinia caerulea | (none) | ------------------------------ |
| Monotropa hypopitys | (none) | ------------------------------ |
| Montia fontana | (none) | ------------------------------ |
| Muscari comosum | (none) | ------------------------------ |
| Mycelis muralis | (none) | ------------------------------ |
| Myosotis arvensis | (none) | ------------------------------ |
| Myosotis discolor | (none) | ------------------------------ |
| Myosurus minimus | (none) | ------------------------------ |
| Myrica gale | (none) | ------------------------------ |
| Myriophyllum alterniflorum | (none) | ------------------------------ |
| Myriophyllum aquaticum | (none) | ------------------------------ |
| Myriophyllum sibiricum | (none) | ------------------------------ |
| Myriophyllum spicatum | (none) | ------------------------------ |
| Myriophyllum verticillatum | (none) | ------------------------------ |
| Najas marina | (none) | ------------------------------ |
| Najas minor | (none) | ------------------------------ |
| Narcissus bicolor | (none) | ------------------------------ |
| Nardus stricta | (none) | ------------------------------ |
| Narthecium asiaticum | (none) | ------------------------------ |
| Narthecium ossifragum | (none) | ------------------------------ |
| Neottia nidus avis | (none) | ------------------------------ |
| Nepeta cataria | (none) | ------------------------------ |
| Neslia paniculata | (none) | ------------------------------ |
| Nicandra physaloides | (none) | TAGGTCGATTTTGTTGGAAAATCCAGGTTA |
| Nuphar lutea | (none) | ------------------------------ |
| Nymphaea alba | (none) | ------------------------------ |
| Nymphoides peltata | (none) | ------------------------------ |
| Odontites serotina | (none) | ------------------------------ |
| Oenanthe lachenalii | (none) | ------------------------------ |
| Oenothera biennis | (none) | ------------------------------ |
| Onobrychis laxiflora | (none) | ------------------------------ |
| Ononis repens | (none) | ------------------------------ |
| Onopordum acanthium | (none) | ------------------------------ |
| Ophrys apifera | (none) | ------------------------------ |
| Ophrys insectifera | (none) | ------------------------------ |
| Orchis militaris | (none) | ------------------------------ |
| Origanum vulgare | (none) | ------------------------------ |
| Ornithogalum longebracteatum | (none) | ------------------------------ |
| Ornithogalum nutans | (none) | ------------------------------ |
| Ornithogalum umbellatum | (none) | ------------------------------ |
| Ornithopus perpusillus | (none) | ------------------------------ |
| Orobanche caryophyllacea | (none) | ------------------------------ |
| Orobanche hederae | (none) | ------------------------------ |
| Orobanche lutea | (none) | ------------------------------ |
| Orobanche minor | (none) | ------------------------------ |
| Orobanche picridis | (none) | ------------------------------ |
| Orobanche purpurea | (none) | ------------------------------ |
| Orobanche rapum-genistae | (none) | ------------------------------ |
| Othocallis siberica | (none) | ------------------------------ |
| Oxalis acetosella | (none) | ------------------------------ |
| Oxalis corniculata | (none) | ------------------------------ |
| Oxalis fontana | (none) | ------------------------------ |
| Panicum miliaceum | (none) | ------------------------------ |
| Papaver argemone | (none) | ------------------------------ |
| Papaver dubium | (none) | ------------------------------ |
| Papaver orientale | (none) | ------------------------------ |
| Papaver rhoeas | (none) | ------------------------------ |
| Papaver somniferum | (none) | ------------------------------ |
| Parapholis incurva | (none) | ------------------------------ |
| Parentucellia viscosa | (none) | ------------------------------ |
| Parietaria pensylvanica | (none) | ------------------------------ |
| Paris violacea | (none) | ------------------------------ |
| Parnassia palustris | (none) | ------------------------------ |
| Parthenocissus quinquefolia | (none) | ------------------------------ |
| Pastinaca sativa | (none) | ------------------------------ |
| Pedicularis foliosa | (none) | ------------------------------ |
| Pedicularis verticillata | (none) | ------------------------------ |
| Pentaglottis sempervirens | (none) | ------------------------------ |
| Persicaria hydropiper | (none) | ------------------------------ |
| Petasites japonicus | (none) | ------------------------------ |
| Petrorhagia velutina | (none) | ------------------------------ |
| Petroselinum crispum | (none) | ------------------------------ |
| Peucedanum carvifolia | (none) | ------------------------------ |
| Phacelia heterophylla | (none) | ------------------------------ |
| Phalaris arundinacea | (none) | ------------------------------ |
| Phaseolus vulgaris | (none) | ------------------------------ |
| Philadelphus caucasicus | (none) | ------------------------------ |
| Philadelphus hirsutus | (none) | ------------------------------ |
| Phleum pratense | (none) | ------------------------------ |
| Phragmites australis | (none) | ------------------------------ |
| Physalis alkekengi | (none) | TAGGTCGATTTTGTTGGAAAATCCAGGTTA |
| Phyteuma spicatum | (none) | ------------------------------ |
| Picris hieracioides | (none) | ------------------------------ |
| Pimpinella saxifraga | (none) | ------------------------------ |
| Pinguicula caerulea | (none) | ------------------------------ |
| Pisum sativum | (none) | ------------------------------ |
| Plantago lanceolata | (none) | ------------------------------ |
| Platanthera chlorantha | (none) | ------------------------------ |
| Platanus occidentalis | (none) | ------------------------------ |
| Poa pratensis | (none) | ------------------------------ |
| Poa trivialis | (none) | ------------------------------ |
| Polycnemum majus | (none) | ------------------------------ |
| Polygala comosa | (none) | ------------------------------ |
| Polygala serpyllifolia | (none) | ------------------------------ |
| Polygala vulgaris | (none) | ------------------------------ |
| Polygonatum oppositifolium | (none) | ------------------------------ |
| Polygonum aviculare | (none) | ------------------------------ |
| Populus tremula | (none) | ------------------------------ |
| Potamogeton crispus | (none) | ------------------------------ |
| Potentilla reptans | (none) | ------------------------------ |
| Primula elatior | (none) | ------------------------------ |
| Primula veris | (none) | ------------------------------ |
| Primula vulgaris | (none) | ------------------------------ |
| Prunella vulgaris | (none) | ------------------------------ |
| Prunus spinosa | (none) | ------------------------------ |
| Pseudofumaria lutea | (none) | ------------------------------ |
| Puccinellia distans | (none) | ------------------------------ |
| Pulicaria dysenterica | (none) | ------------------------------ |
| Pulmonaria angustifolia | (none) | ------------------------------ |
| Pulsatilla vulgaris | (none) | ------------------------------ |
| Pyrola minor | (none) | ------------------------------ |
| Pyrola rotundifolia | (none) | ------------------------------ |
| Pyrus communis | (none) | ------------------------------ |
| Quercus robur | (none) | ------------------------------ |
| Radiola linoides | (none) | ------------------------------ |
| Ranunculus macranthus | (none) | ------------------------------ |
| Ranunculus repens | (none) | ------------------------------ |
| Raphanus sativus | (none) | ------------------------------ |
| Rapistrum rugosum | (none) | ------------------------------ |
| Reseda alba | (none) | ------------------------------ |
| Reseda lutea | (none) | ------------------------------ |
| Reseda luteola | (none) | ------------------------------ |
| Rhamnus catharticus | (none) | ------------------------------ |
| Rhamnus cathartica | (none) | ------------------------------ |
| Rhinanthus alectorolophus | (none) | ------------------------------ |
| Rhododendron ponticum | (none) | ------------------------------ |
| Rhynchospora alba | (none) | ------------------------------ |
| Rhynchospora nervosa | (none) | ------------------------------ |
| Ribes alpinum | (none) | ------------------------------ |
| Ribes aureum | (none) | ------------------------------ |
| Ribes nigrum | (none) | ------------------------------ |
| Ribes rubrum | (none) | ------------------------------ |
| Ribes uva-crispa | (none) | ------------------------------ |
| Ricinus communis | (none) | ------------------------------ |
| Robinia pseudoacacia | (none) | ------------------------------ |
| Rorippa palustris | (none) | ------------------------------ |
| Rosa arvensis | (none) | ------------------------------ |
| Rosa woodsii | (none) | ------------------------------ |
| Rubus idaeus | (none) | ------------------------------ |
| Rudbeckia laciniata | (none) | ------------------------------ |
| Rumex acetosa | (none) | ------------------------------ |
| Ruppia cirrhosa | (none) | ------------------------------ |
| Ruppia maritima | (none) | ------------------------------ |
| Sagina procumbens | (none) | ------------------------------ |
| Sagittaria latifolia | (none) | ------------------------------ |
| Salicornia meyeriana | (none) | ------------------------------ |
| Salix alba | (none) | ------------------------------ |
| Salix fragilis | (none) | ------------------------------ |
| Salsola kali | (none) | ------------------------------ |
| Salvia pratensis | (none) | ------------------------------ |
| Sambucus canadensis | (none) | ------------------------------ |
| Sambucus ebulus | (none) | ------------------------------ |
| Sambucus nigra | (none) | ------------------------------ |
| Sambucus racemosa | (none) | ------------------------------ |
| Samolus valerandi | (none) | ------------------------------ |
| Sanguisorba officinalis | (none) | ------------------------------ |
| Sanicula europaea | (none) | ------------------------------ |
| Sanicula maritima | (none) | ------------------------------ |
| Saponaria officinalis | (none) | ------------------------------ |
| Saxifraga cernua | (none) | ------------------------------ |
| Saxifraga granulata | (none) | ------------------------------ |
| Saxifraga tridactylites | (none) | ------------------------------ |
| Scabiosa columbaria | (none) | ------------------------------ |
| Scandix pecten-veneris | (none) | ------------------------------ |
| Scheuchzeria palustris | (none) | ------------------------------ |
| Schoenoplectus tabernaemontani | (none) | ------------------------------ |
| Schoenus nigricans | (none) | ------------------------------ |
| Scilla scilloides | (none) | ------------------------------ |
| Scirpus sylvaticus | (none) | ------------------------------ |
| Scleranthus perennis | (none) | ------------------------------ |
| Scorzonera humilis | (none) | ------------------------------ |
| Scrophularia canina | (none) | ------------------------------ |
| Scrophularia sp | (none) | ------------------------------ |
| Scutellaria sieberi | (none) | ------------------------------ |
| Secale strictum | (none) | ------------------------------ |
| Secale sylvestre | (none) | ------------------------------ |
| Securigera varia | (none) | ------------------------------ |
| Sedum rubrotinctum | (none) | ------------------------------ |
| Selinum carvifolia | (none) | ------------------------------ |
| Sempervivum tectorum | (none) | ------------------------------ |
| Senecio vulgaris | (none) | ------------------------------ |
| Serratula tinctoria | (none) | ------------------------------ |
| Sesleria caerulea | (none) | ------------------------------ |
| Setaria italica | (none) | ------------------------------ |
| Sherardia arvensis | (none) | ------------------------------ |
| Silaum silaus | (none) | ------------------------------ |
| Silene dioica | (none) | ------------------------------ |
| Silene nutans | (none) | ------------------------------ |
| Sinapis alba | (none) | ------------------------------ |
| Sisymbrium altissimum | (none) | ------------------------------ |
| Sisymbrium irio | (none) | ------------------------------ |
| Sium latifolium | (none) | ------------------------------ |
| Solanum tuberosum | (none) | GTTGGATTCAAAGCTGGTGTTAAAGAGTAC |
| Solidago gigantea | (none) | ------------------------------ |
| Sonchus oleraceus | (none) | ------------------------------ |
| Sorbus aucuparia | (none) | ------------------------------ |
| Sparganium angustifolium | (none) | ------------------------------ |
| Sparganium natans | (none) | ------------------------------ |
| Sparganium stoloniferum | (none) | ------------------------------ |
| Spartina anglica | (none) | ------------------------------ |
| Spergula arvensis | (none) | ------------------------------ |
| Spergularia rubra | (none) | ------------------------------ |
| Spinacia oleracea | (none) | ------------------------------ |
| Spiraea cantoniensis | (none) | ------------------------------ |
| Spiraea x vanhouttei | (none) | ------------------------------ |
| Spiranthes spiralis | (none) | ------------------------------ |
| Spirodela polyrhiza | (none) | ------------------------------ |
| Stachys sylvatica | (none) | ------------------------------ |
| Stellaria media | (none) | ------------------------------ |
| Stratiotes aloides | (none) | ------------------------------ |
| Suaeda maritima | (none) | ------------------------------ |
| Succisa pratensis | (none) | ------------------------------ |
| Symphoricarpos albus | (none) | ------------------------------ |
| Symphytum x uplandicum | (none) | ------------------------------ |
| Syringa vulgaris | (none) | ------------------------------ |
| Tanacetum vulgare | (none) | ------------------------------ |
| Taraxacum officinale | (none) | ------------------------------ |
| Teesdalia nudicaulis | (none) | ------------------------------ |
| Tephroseris palustris | (none) | ------------------------------ |
| Tetragonia tetragonioides | (none) | ------------------------------ |
| Tetragonolobus maritimus | (none) | ------------------------------ |
| Teucrium bidentatum | (none) | ------------------------------ |
| Thalictrum alpinum | (none) | ------------------------------ |
| Thesium strictum | (none) | ------------------------------ |
| Thlaspi arvense | (none) | ------------------------------ |
| Thymus vulgaris | (none) | ------------------------------ |
| Tilia americana | (none) | ------------------------------ |
| Tilia cordata | (none) | ------------------------------ |
| Tilia platyphyllos | (none) | ------------------------------ |
| Torilis arvensis | (none) | ------------------------------ |
| Tragopogon dubius | (none) | ------------------------------ |
| Trapa natans | (none) | ------------------------------ |
| Trichophorum cespitosum | (none) | ------------------------------ |
| Trientalis europaea | (none) | ------------------------------ |
| Trifolium repens | (none) | ------------------------------ |
| Triglochin maritimum | (none) | ------------------------------ |
| Triglochin palustris | (none) | ------------------------------ |
| Tripleurospermum caucasicum | (none) | ------------------------------ |
| Trisetum flavescens | (none) | ------------------------------ |
| Triticosecale sp | (none) | ------------------------------ |
| Triticum aestivum | (none) | ------------------------------ |
| Tuberaria guttata | (none) | ------------------------------ |
| Tulipa chrysantha | (none) | ------------------------------ |
| Tussilago farfara | (none) | ------------------------------ |
| Typha angustifolia | (none) | ------------------------------ |
| Typha latifolia | (none) | ------------------------------ |
| Ulex europaeus | (none) | ------------------------------ |
| Ulmus americana | (none) | ------------------------------ |
| Ulmus glabra | (none) | ------------------------------ |
| Ulmus minor | (none) | ------------------------------ |
| Urtica dioica | (none) | ------------------------------ |
| Utricularia australis | (none) | ------------------------------ |
| Utricularia biflora | (none) | ------------------------------ |
| Utricularia intermedia | (none) | ------------------------------ |
| Utricularia minor | (none) | ------------------------------ |
| Utricularia olivacea | (none) | ------------------------------ |
| Utricularia vulgaris | (none) | ------------------------------ |
| Vaccinium uliginosum | (none) | ------------------------------ |
| Valeriana dioica | (none) | ------------------------------ |
| Valerianella locusta | (none) | ------------------------------ |
| Verbascum speciosum | (none) | ------------------------------ |
| Verbena officinalis | (none) | ------------------------------ |
| Veronica agrestis | (none) | ------------------------------ |
| Veronica anagallis-aquatica | (none) | ------------------------------ |
| Veronica arvensis | (none) | ------------------------------ |
| Veronica austriaca | (none) | ------------------------------ |
| Veronica beccabunga | (none) | ------------------------------ |
| Veronica chamaedrys | (none) | ------------------------------ |
| Veronica hederifolia | (none) | ------------------------------ |
| Veronica longifolia | (none) | ------------------------------ |
| Veronica montana | (none) | ------------------------------ |
| Veronica officinalis | (none) | ------------------------------ |
| Veronica opaca | (none) | ------------------------------ |
| Veronica peregrina | (none) | ------------------------------ |
| Veronica persica | (none) | ------------------------------ |
| Veronica polita | (none) | ------------------------------ |
| Veronica praecox | (none) | ------------------------------ |
| Veronica prostrata | (none) | ------------------------------ |
| Veronica scutellata | (none) | ------------------------------ |
| Veronica serpyllifolia | (none) | ------------------------------ |
| Veronica triphyllos | (none) | ------------------------------ |
| Veronica verna | (none) | ------------------------------ |
| Viburnum acerifolium | (none) | ------------------------------ |
| Viburnum lantana | (none) | ------------------------------ |
| Viburnum opulus | (none) | ------------------------------ |
| Vicia faba | (none) | ------------------------------ |
| Vinca minor | (none) | ------------------------------ |
| Vincetoxicum hirundinaria | (none) | ------------------------------ |
| Viola arvensis | (none) | ------------------------------ |
| Viola biflora | (none) | ------------------------------ |
| Viola canina | (none) | ------------------------------ |
| Viola curtisii | (none) | ------------------------------ |
| Viola decumbens | (none) | ------------------------------ |
| Viola hirta | (none) | ------------------------------ |
| Viola lutea calaminaria | (none) | ------------------------------ |
| Viola odorata | (none) | ------------------------------ |
| Viola persicifolia | (none) | ------------------------------ |
| Viola pubescens | (none) | ------------------------------ |
| Viola reichenbachiana | (none) | ------------------------------ |
| Viola riviniana | (none) | ------------------------------ |
| Viola rupestris | (none) | ------------------------------ |
| Viola tricolor | (none) | ------------------------------ |
| Viscum album | (none) | ------------------------------ |
| Vulpia myuros | (none) | ------------------------------ |
| Wolffia arrhiza | (none) | ------------------------------ |
| Xanthium strumarium | (none) | ------------------------------ |
| Zannichellia palustris | (none) | ------------------------------ |
| Zea mays | (none) | ------------------------------ |
| Zostera marina | (none) | ------------------------------ |
| Zostera noltii | (none) | ------------------------------ |
Columns
None of the columns has a description.
