@ARTICLE{TreeBASE2Ref21968,
author = {Kate M Halpin and Mark Fishbein},
title = {A Chloroplast Phylogeny of Agavaceae subfamily Chlorogaloideae: Implications for the Tempo of Evolution on Serpentine Soils},
year = {2013},
keywords = {Bimodal karyotype, Camassia, Chlorogalum, edaphic endemism, Hastingsia, Hesperocallis, Schoenolirion.},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Agavaceae subfamily Chlorogaloideae is composed of the North American genera Camassia, Chlorogalum, Hastingsia, and Schoenolirion, with many species occupying serpentine soils or other poor soils with unusual chemistries. The monophyly and intergeneric relationships of this group have not been rigorously assessed. We estimated the phylogeny of Chlorogaloideae using four chloroplast DNA regions: rpl16 intron and trnD?trnY?trnE?trnT, psbJ?petA, and trnS?trnfM spacers, with the goals of evaluating 1) the monophyly of Chlorogaloideae, 2) the monophyly of each genus and generic interrelationships, 3) the placement of Chlorogaloideae in Agavaceae, and 4) the history of adaptation onto serpentine soils. Maximum parsimony, maximum likelihood, and Bayesian analyses provided concordant estimates of the phylogeny supporting the monophyly of a clade consisting of Camassia, Chlorogalum, and Hastingsia, but suggest that Schoenolirion may be more closely related to Hesperoyucca and Hesperaloe. Each genus of Chlorogaloideae was found to be monophyletic except Chlorogalum, with C. parviflorum and C. purpureum forming a paraphyletic grade to other Chlorogalum, Camassia, and Hastingia. Ancestral character reconstructions employing parsimony, likelihood, and stochastic mapping suggest that serpentine tolerance evolved multiple times in Chlorogaloideae. We discuss the significance of the estimated phylogeny for the evolution of the distinctive bimodal karyotype of Agavaceae.}
}
Matrix 21773 of Study 13668

Citation title:
"A Chloroplast Phylogeny of Agavaceae subfamily Chlorogaloideae: Implications for the Tempo of Evolution on Serpentine Soils".

Study name:
"A Chloroplast Phylogeny of Agavaceae subfamily Chlorogaloideae: Implications for the Tempo of Evolution on Serpentine Soils".

This study is part of submission 13668
(Status: Published).
Matrices
Title: Pedaliaceae ETS sequences
Description: nuclear ETS region
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Sesamothamnus leistnerii 02 33 |
(none)
|
------ACTCACCACTAACCGCACATACCC |
| Sesamothamnus guerichii 12 36 |
(none)
|
------------------------------ |
| Sesamum abbreviatum 07 44 |
(none)
|
-----------CCACTAACCGCACATACCC |
| Sesamum capense 07 163 |
(none)
|
--------------CTAACCGCACATACCC |
| Sesamum capense 07 46 |
(none)
|
---------CACCACTAACCGCACATACCC |
| Sesamum indicum AF478978 |
(none)
|
---------------------CACACACC- |
| Sesamum alatum 07 43 |
(none)
|
-----------------------CATACCC |
| Sesamum schenckii 07 178 |
(none)
|
TCGCGCACTCACCACTAACCGCACATACCC |
| Sesamum lepidotum 07 45 |
(none)
|
------------------------------ |
| Sesamum lepidotum 12 34 |
(none)
|
------------------------------ |
| Sesamum rigidum ssp merenskyanum 07 48 |
(none)
|
----------ACCACTAACCGCACATGCCC |
| Sesamum rigidum ssp merenskyanum 07 183 |
(none)
|
------------------------------ |
| Ceratotheca triloba 07 156 |
(none)
|
-----------CCACTAACCGCACACACCC |
| Ceratotheca sesamoides 12 31 |
(none)
|
------------------------------ |
| Ceratotheca sesamoides 07 162 |
(none)
|
------------------------------ |
| Holubia saccata 09 49 |
(none)
|
------------------------------ |
| Harpagophytum procumbens 99 112 |
(none)
|
---CGCACTCACCACTAACCGCACATACCA |
| Harpagophytum zeyheri 99 152 |
(none)
|
------------------------------ |
| Pedaliodiscus macrocarpus 06 101 |
(none)
|
-----CACTCACCACTATCCGCAGGTTCCC |
| Pedalium murex 07 179 |
(none)
|
------------------------ATTCCC |
| Pedalium murex 09 51 |
(none)
|
------------------------ATTCCC |
| Pterodiscus aurantiacus 06 98 |
(none)
|
TCGCGCACTCACCACAATCCGCATATTCCC |
| Pterodiscus kellerianus 12 39 |
(none)
|
---------------TATCCGCAGATTCCC |
| Rogeria longiflora 02 54A |
(none)
|
------ACTCACCACAAACCGCACATACCC |
| Rogeria adenophylla 12 32 |
(none)
|
------------------------------ |
| Uncarina grandidieri 09 115 |
(none)
|
TCGCGCACTCACCACTAACCGCACATACCC |
| Proboscidea louisianica 07 110 |
(none)
|
-----------CCACGAACCGCACATACCC |
| Martynia fragrans 09 117 |
(none)
|
---------------GAACCGCACATACCC |
| Proboscidea altheaefolia 09 112 |
(none)
|
------------------------------ |
| Ibicella parodii 07 156 |
(none)
|
------------------------------ |
| Buddleja incana 2011 223 |
(none)
|
------------------------------ |
Columns
None of the columns has a description.