@ARTICLE{TreeBASE2Ref14970,
author = {Priscila Chaverri and Joseph Frank Bischoff and Harry C. Evans and Kathie T. Hodge},
title = {Regiocrella, a new entomopathogenic genus with a pycnidial anamorph and its phylogenetic placement in the Clavicipitaceae},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {A new genus, Regiocrella, is described with two species, R. camerunensis and R. sinensis, based on specimens collected in Cameroon and China. Both species are parasitic on scale insects (Coccidae, Homoptera). Morphological and molecular evidence place the new genus in the Clavicipitaceae (Hypocreales), despite its combination of characters that are atypical of that family: Regiocrella is characterized by having perithecia partly immersed in a subiculum, non-capitate asci, unicellular fusiform ascospores, and pycnidial-acervular conidiomata. The two new species, R. camerunensis and R. sinensis, are distinguished based on ascospore and perithecium size. Morphological characters were evaluated and compared to other genera in the Clavicipitaceae, especially those parasitic on scale insects or with pycnidial-acervular anamorphs or synanamorphs (i.e. Aschersonia, Ephelis, or Sphacelia): Atkinsonella, Balansia, Claviceps, Epichl?e, Hypocrella, Myriogenospora, and Neoclaviceps. The phylogenetic relationships of Regiocrella were examined using three gene loci: large subunit nuclear ribosomal DNA (LSU), translation elongation factor 1-a (TEF), and RNA polymerase II subunit 1 (RPB1). The results of this study confirm that Regiocrella is distinct from other genera in the Clavicipitaceae, and that its two species form a monophyletic group. Regiocrella is shown to be closely related to the scale insect pathogen Hypocrella and the plant-associated genera Balansia, Claviceps, Epichl?e, Myriogenospora, and Neoclaviceps. This study also provides insights into the evolution of pycnidial-acervular conidiomata and scale insect parasitism within the Clavicipitaceae. Plant-associated genera form a monophyletic group correlated with Clavicipitaceae subfamily Clavicipitoideae sensu Diehl. We also demonstrate that scale insect parasites have multiple evolutionary origins within the family and genera with pycnidial-acervular anamorphs or synanamorphs have a single origin.}
}
Matrix 1497 of Study 1385

Citation title:
"Regiocrella, a new entomopathogenic genus with a pycnidial anamorph and its phylogenetic placement in the Clavicipitaceae".

This study was previously identified under the legacy study ID S1315
(Status: Published).
Matrices
Title: RPB1, EF, LSU
Description: Legacy TreeBASE Matrix ID = M2308
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Hypocrea lutea |
(none)
|
ATCAAGAAAGTCAAGAAGATCCTGGAAATT |
Hypocrea rufa |
(none)
|
?????????????????????CTGGAAATT |
Cordyceps capitata |
(none)
|
?????????????????????????????? |
Cordyceps gunnii |
(none)
|
?????????????????????????????? |
Cordyceps heteropoda |
(none)
|
?????????????????????????????? |
Balansia henningsiana |
(none)
|
?????????????????????????????? |
Cordyceps ophioglossoides |
(none)
|
?????????????????????????????? |
Epichloe typhina |
(none)
|
ATCAAGAAGGTCAAGAAGATCTTGGAGATT |
Myriogenospora atramentosa |
(none)
|
?????????????????????????????? |
Polycephalomyces formosus |
(none)
|
ATCAAGAAAGTCAAGAAGATCCTGGAGATA |
Cordyceps ramosopulvinata |
(none)
|
ATCAAGAAAGTCAAGAAGATCCTGGAGATA |
Cordyceps inegoensis |
(none)
|
ATCAAGAAGGTCAAGAAGATCTTGGAGATT |
Torrubiella sp JB207 |
(none)
|
ATCAAGAAGGTCAAGAAGATCTTGGAGATT |
Ascopolyporus villosus |
(none)
|
ATTAAAAAAGTGAAAAAGGTTTTGGAGATT |
Torrubiella piperis |
(none)
|
ATCAAGAAAGTCAAGAAGGTTTTGGAGATC |
Neoclaviceps monostipa |
(none)
|
ATCAAGAAGGTCAAGAAGATCTTTGGTATT |
Claviceps purpurea |
(none)
|
ATCAGGAAGGTCAAAAAGATTTTGGAGATG |
Epichloe elymi |
(none)
|
?TCAAGAAGGTCAAGAAGATCTTGGAGATT |
Torrubiella sp PC385 |
(none)
|
ATCAAGAAAGTGAAAAAGGTTTTGGAGATT |
Podocrella harposporifera |
(none)
|
ATCAAGAAGGTCAAGAAGATCTTGGAGATT |
Hyperdermium pulvinatum |
(none)
|
ATCAAGAAAGTGAAGAAGGTTTTGGAGATC |
Ascopolyporus polychrous |
(none)
|
?TCAAGAAAGTGAAAAAGGTTTTGGAGATT |
Regiocrella sinensis |
(none)
|
??CAAGAAGGTCAAGAAGATCTTGGAGATT |
Regiocrella camerunensis |
(none)
|
?TCAAGAAGGTCAAGAAGATCTTGGAGATT |
Aschersonia viridans |
(none)
|
ATCAAGAAAGTCAAGAAAATCCTGGAGATT |
Aschersonia napoleonae |
(none)
|
ATCAAGAAAGTCAAGAAGATCCTGGAGATT |
Columns
None of the columns has a description.