@ARTICLE{TreeBASE2Ref14822,
author = {Laura Braendli and L. J. Handley and Peter Vogel and Nicolas Perrin},
title = {Evolutionary history of the greater white-toothed shrew (Crocidura russula) inferred from analysis of mtDNA, Y and X chromosome markers},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {We investigate the evolutionary history of the greater white-toothed shrew across its distribution in Northern Africa and mainland Europe using sex specific (mtDNA and Y chromosome) and biparental (X chromosome) markers. All three loci confirm a large divergence between eastern (Tunisia and Sardinia) and western (Morocco and mainland Europe) lineages, and application of a molecular clock to mtDNA divergence estimates indicates a more ancient separation (2.25 Myr ago) than described by some previous studies, supporting claims for taxonomic revision. Moroccan ancestry for the mainland European population is inconclusive from phylogenetic trees, but is supported by greater nucleotide diversity and a more ancient population expansion in Morocco than in Europe. Signatures of rapid population expansion in mtDNA, combined with low X and Y chromosome diversity, suggest a single colonization of mainland Europe by a small number of Moroccan shrews >38 Kyr ago. This study illustrates that multilocus genetic analyses can facilitate the interpretation of species evolutionary history but that phylogeographic inference using X and Y chromosomes is restricted by low levels of observed polymorphism.}
}
Matrix 1499 of Study 1386

Citation title:
"Evolutionary history of the greater white-toothed shrew (Crocidura russula) inferred from analysis of mtDNA, Y and X chromosome markers".

This study was previously identified under the legacy study ID S1316
(Status: Published).
Matrices
Title: Chromosome Y
Description: Legacy TreeBASE Matrix ID = M2310
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Crocidura canariensis |
(none)
|
CTAAGGTCAGATTTTTGTATTTATTTTGGG |
Crocidura leucodon H11 |
(none)
|
CTAAGGTCAGATTTTT-TATTTATTTTGGG |
Crocidura russula H7 |
(none)
|
CTAAGGTCAGATTTTTGTATTTATTTTGGG |
Crocidura russula H6 |
(none)
|
CTAAGGTCAGTTTTTTGTATTTATTTTGGG |
Crocidura russula H2 |
(none)
|
CTAAGGTCAGTTTTTTGTATTTATTTTGGG |
Crocidura russula H5 |
(none)
|
CTAAGGTCAGTTTTTTGTATTTATTTTGGG |
Crocidura russula H1 |
(none)
|
CTAAGGTCAGTTTTTTGTATTTATTTTGGG |
Crocidura russula H4 |
(none)
|
CTAAGGTCAGTTTTTTGTATTTATTTTGGG |
Crocidura russula H3 |
(none)
|
CTAAGGTCAGTTTTTTGTATTTATTTTGGG |
Crocidura russula H10 |
(none)
|
CTAAGGTCAGATTTTTGTATTTATTTTGGG |
Crocidura russula H9 |
(none)
|
CTAAGGTCAGATTTTTGTATTTATTTTGGG |
Crocidura russula H8 |
(none)
|
CTAAGGTCAGATTTTTGTATTTATTTTGGG |
Columns
None of the columns has a description.