@ARTICLE{TreeBASE2Ref18024,
author = {Bo Wang and Curt L. Brubaker and Walter Tate and Matthew Woods and B. A. Matheson and Jeremy J. Burdon},
title = {AFLP analyses and gene genealogies support local origin of two VCGs of Fusarium oxysporum f.sp. vasinfectum in Australia},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Phytopathology},
volume = {},
number = {},
pages = {},
abstract = {Genetic diversity of Fusarium oxysporum f. sp. vasinfectum (Fov) and non-pathogenic F. oxysporum from an area believed to be the center of origin of two VCGs of Fov in Australia was determined using AFLPs. Three lineages (designated as Lineages A, B, and E) were identified among the 294 isolates, of which 99 were pathogenic on cotton (Gossypium hirsutum), i.e., could be designated Fov (81 from diseased cotton plants and 18 from field soil); 195 isolates were non-pathogenic (160 from field soil and 35 from uncultivated soil). All pathogenic isolates, regardless of origin, belonged to Lineage A. They represented eight haplotypes that fell into two subgroups. One subgroup contained isolates known to belong to VCG 01111, while the other subgroup contained VCG 01112 isolates. The 13 non-pathogenic Lineage A isolates represented 11 haplotypes (11 from field soil and two from uncultivated soil). Sequencing of the EF-1? and mtSSU genes confirmed that the non-pathogenic Lineage A isolates were more closely related to the Fov isolates than they were to the Lineages B and E isolates. Lineages B and E contained 26 and 50 haplotypes, respectively. The diversity of the Lineage B isolates was greatest in the uncultivated soil, while the diversity of the Lineage E isolates was greatest in the cultivated soils. This is the first report of a F. oxysporum pathogen with a close phylogenetic relationship to co-occurring non-pathogenic F. oxysporum in both cultivated and uncultivated soils.}
}
Matrix 19766 of Study 1537

Citation title:
"AFLP analyses and gene genealogies support local origin of two VCGs of Fusarium oxysporum f.sp. vasinfectum in Australia".

This study was previously identified under the legacy study ID S1482
(Status: Published).
Matrices
Title: Sparganium 28 taxa, 4-gene alignment
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Brocchinia prismatica |
(none)
|
AACCTGCTAAGTGGTAACTTTCAAATTCAG |
| Puya ferruginea |
(none)
|
------------------------------ |
| Puya venusta |
(none)
|
-------------------TCCAAATTCAG |
| Sparganium americanum |
(none)
|
----------GTGTTAACTTCCAAATTCAG |
| Sparganium androcladum |
(none)
|
----------GTGTTAACTTCCAAATTCAG |
| Sparganium angustifolium |
(none)
|
-----GCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium angustifolium 2 |
(none)
|
----------------ACTTCCAAATTCAG |
| Sparganium angustifolium 3 |
(none)
|
----------GTGTTAACTTCCAAATTCAG |
| Sparganium emersum |
(none)
|
--CCTGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium erectum subsp. stoloniferum |
(none)
|
---CTGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium erectum subsp. stoloniferum var. macrocarpum |
(none)
|
------------------------------ |
| Sparganium eurycarpum |
(none)
|
----------GTGTTAACTTCCAAATTCAG |
| Sparganium eurycarpum Engelm.var. greenei |
(none)
|
AACCTGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium fallax 1 |
(none)
|
------------------------------ |
| Sparganium fallax 2 |
(none)
|
-----------TGTTAACTTCCAAATTCAG |
| Sparganium fluctuans |
(none)
|
AACCTGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium glomeratum |
(none)
|
AACCTGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium glomeratum 2 |
(none)
|
------CTAAGTGTTAACTTCCAAATTCAG |
| Sparganium glomeratum 3 |
(none)
|
-----GCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium gramineum |
(none)
|
----TGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium hyperboreum |
(none)
|
----------GTGTTAACTTCCAAATTCAG |
| Sparganium japonicum |
(none)
|
--CCTGCTAAGTGTTAACTTCCAAATTCAG |
| Sparganium natans |
(none)
|
-------------------------TTCAG |
| Sparganium subglobosum 1 |
(none)
|
------------------------------ |
| Typha angustifolia |
(none)
|
----TGCTAAGTGTTAACTTCCAAATTCAG |
| Typha domingensis |
(none)
|
-----GCTAAGTGTTAACTTCCAAATTCAG |
| Typha latifolia |
(none)
|
AACCTGCTAAGTGTTAACTTCCAAATTCAG |
| Typha orientalis |
(none)
|
-----------------CTTCCAAATTCAG |
Columns
None of the columns has a description.