@ARTICLE{TreeBASE2Ref18118,
author = {Justen B. Whittall and Matthew L. Carlson and Robert J. Meinke and Aaron Liston},
title = {The Mimulus moschatus Alliance (Phrymaceae): Molecular and Morphological Phylogenetics and their Conservation Implications},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {The Mimulus moschatus alliance consists of thirteen morphologically similar species, the majority of which have been considered for conservation protection. Phylogenetic analyses of four rapidly evolving molecular DNA regions (ITS, ETS, trnL-F, and rpl16) and a morphological data set under several optimality criteria reveal that the M. moschatus alliance is composed of three geographically defined clades: the Sierra Nevada Clade (M. floribundus, M. norrisii and M. dudleyi), the Snake River Clade (M. hymenophyllus, M. ampliatus and M. patulus) and the Columbia River Clade (M. washingtonensis and M. jungermannioides). The relationships within and among the clades are well resolved. Numerous instances of morphological homoplasy among the clades are inferred. Although nearly half of the morphological characters are highly homoplasious, the inclusion of a morphological data set in the combined parsimony and Bayesian analyses improves phylogenetic resolution and support. The phylogeny reveals three independent origins of a habitat adapted to cliff environments and three separate origins of the autogamous mating system. The phylogenetic results indicate the specific recognition of three rare taxa (M. ampliatus, M. patulus, and M. dudleyi), previously synonymized with more widespread species. A key to the species within the M. moschatus alliance is provided.}
}
Matrix 2732 of Study 1395

Citation title:
"The Mimulus moschatus Alliance (Phrymaceae): Molecular and Morphological Phylogenetics and their Conservation Implications".

This study was previously identified under the legacy study ID S1326
(Status: Published).
Matrices
Title: mimulus moschatus molecular matrix
Description: Legacy TreeBASE Matrix ID = M2324
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Mimulus bodinieri |
(none)
|
?????TGCGTA?CGGC?TTTCGGATCC?TG |
Mimulus guttatus CA |
(none)
|
CTTGGTGCGCACGGGCTTGTCGGATCCCTG |
Mimulus nepalensis |
(none)
|
CTTGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus tenellus |
(none)
|
CTTGGTGCG?ACGGGCTTGTCGGATCCCTG |
Mimulus floribundus CO |
(none)
|
C?TGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus alsinoides |
(none)
|
??CGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus guttatus OR |
(none)
|
CTTGGTGCGCACGGGCTTGTCGGATCCCTG |
Mimulus dentatus |
(none)
|
??????GCGTACGGGCTTGTCGGATCCCTG |
Mimulus dudleyi |
(none)
|
CTTGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus norrisii |
(none)
|
?????GTGCTA?CGGCTTGTCGGATCC?TG |
Mimulus floribundus OR |
(none)
|
CTTGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus latidens |
(none)
|
CTTGGTG?ATACGGG?TT?TCGGATCCCTG |
Mimulus moschatus |
(none)
|
CTTGTGTGGTA?GGGCTTGTCGGATCCCTG |
Mimulus washingtonensis |
(none)
|
???GG?GCGTACGGGCTTGTCGGATCCCTG |
Mimulus jungermannioides |
(none)
|
???GGTGC?TACGGGCTTGTCGGATCC?TG |
Mimulus breviflorus |
(none)
|
CTTGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus pulsiferae |
(none)
|
CTTGGTGCGTACGGGCTTGTCGGATCC?TG |
Mimulus patulus |
(none)
|
?????TGCG?ACGGGCTTGTC?GATCCCTG |
Mimulus hymenophyllus |
(none)
|
?CTGGTGCGTACGGGCTTGTCGGATCCCTG |
Mimulus ampliatus |
(none)
|
CTTG?TG?GTACGGGCTTGTCGGATCCCTG |
Mimulus primuloides |
(none)
|
????GTGCGTATGGGCATGTCGGATCCCTG |
Mimulus lewisii |
(none)
|
????GTGCGTATGGGCATGTCGGATCCCTG |
Mimulus bicolor |
(none)
|
CTTGGTGCGTATGGGCATGTCGGATCCCTG |
Columns
None of the columns has a description.