@ARTICLE{TreeBASE2Ref18240,
author = {M. J. Yoo and Charles D. Bell and Pamela S. Soltis and Douglas E. Soltis},
title = {Divergence Times and Historical Biogeography of Nymphaeles},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Nymphaeales (Nymphaeaceae and Cabombaceae) comprise eight genera and approximately 70 species of aquatic plants, with a worldwide distribution in tropical to temperate regions. Previous analyses of molecular and morphological data have provided a well-resolved and strongly supported generic-level phylogeny for the order. Using published nuclear 18S rDNA and plastid rbcL and matK DNA sequences and a published topology for Nymphaeales, we estimated the divergence times of genera in this clade. We applied four different methods, a strict molecular clock, nonparametric rate smoothing (NPRS), penalized likelihood (PL), and a Bayesian method, to estimate divergence times. We calibrated the trees by using the minimum age of the angiosperm crown group constrained to 131.8 mya. Our results indicate that extant Nymphaeales diversified into two major clades corresponding to Cabombaceae and Nymphaeaceae during the Eocene (44.6?7.9 mya); extant genera of Nymphaeaceae date to 41.1?7.7 mya, and extant Cabombaceae diversified during the Miocene (19.9?5.6 mya). Whereas the stem lineage of Nymphaeales is old based on fossil evidence (125-115 mya), our results indicate that extant Nymphaeales diversified relatively recently. In another set of analyses we used PL to estimate the age of the angiosperms using two prominent Nymphaeales fossils as calibration points. These analyses suggest that these Nymphaeales fossils may be attached at deeper nodes than proposed in earlier studies. Using dispersal-vicariance analysis, we infer that the ancestor of Nymphaeales occupied the American and Eurasian continents during the Eocene and that the present distributional patterns require several subsequent dispersal and extinction events. This biogeographic inference is supported by the fossil record.}
}
Matrix 2789 of Study 1397

Citation title:
"Divergence Times and Historical Biogeography of Nymphaeles".

This study was previously identified under the legacy study ID S1328
(Status: Published).
Matrices
Title: 18S.nex
Description: Legacy TreeBASE Matrix ID = M2327
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Ginkgo |
(none)
|
---------------TCAAAGATTAAGCCA |
Larix |
(none)
|
---------------TCAAAGATTAAGCCA |
Taxus |
(none)
|
---------------TCAAAGATTAAGCCA |
Gnetum |
(none)
|
-------------------AGATTAAGCCA |
Amborella |
(none)
|
AGTCATATGCTTGTCTCAAAGATTAAGCCA |
Schisandra |
(none)
|
AGTCATATGCTTGTCTCAAAGATTAAGCCA |
Illicium |
(none)
|
-GTCATATGC??GTCTCAAAGATTAAGCCA |
Austrobaileya |
(none)
|
AGTCATATGCTTGTCTCAAAGATTAAGCCA |
Victoria |
(none)
|
---------------TCAAAGATTAAGCCA |
Ondinea |
(none)
|
-----------------AAAGATTAAGCCA |
Nymphaea |
(none)
|
---------------TCAAAGATTAAGCCA |
Nuphar |
(none)
|
---------------TCAAAGATTAAGCCA |
Euryale |
(none)
|
----------------CAAAGATTAAGCCA |
Cabomba |
(none)
|
--------GCTTGTCTCAAAGATTAAGCCA |
Brasenia |
(none)
|
--------------TTCAAAGATTAAGCCA |
Barclaya |
(none)
|
--------------CTCAAAGATTAAGCCA |
Columns
None of the columns has a description.