Matrix 21709 of Study 14179
Matrices
Title: Passerines RAG1 gene
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Abroscopus albogularis | (none) | ------------------------------ |
| Abroscopus schisticeps | (none) | ------------------------------ |
| Abroscopus superciliaris | (none) | ------------------------------ |
| Acanthis flavirostris | (none) | ------------------------------ |
| Acanthisitta chloris | (none) | TAAAGTGCGATCGTTTGATAAAACACCCTC |
| Acridotheres fuscus | (none) | TAAATTGCCATCATTTGAAAAAACACCCTC |
| Acridotheres ginginianus | (none) | ------------------------------ |
| Acridotheres grandis | (none) | ------------------------------ |
| Acridotheres tristis | (none) | TAAATTGCCATCATTTGAAAAAACACCGTC |
| Acrocephalus concinens | (none) | -------------------------CCCTC |
| Acrocephalus stentoreus | (none) | ------------------------------ |
| Actinodura egertoni | (none) | ------------------------------ |
| Actinodura nipalensis | (none) | ------------------------------ |
| Actinodura waldeni | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Aegithalos concinnus | (none) | ------------------------------ |
| Aegithalos iouschistos | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Aegithalos leucogenys | (none) | ------------------------------ |
| Aegithalos niveogularis | (none) | ------------------------------ |
| Aegithina tiphia | (none) | TAAGTTGCGATCATTTGAAAAAACACCCTC |
| Aethopyga gouldiae | (none) | ------------------------------ |
| Aethopyga ignicauda | (none) | ------------------------------ |
| Aethopyga nipalensis | (none) | ------------------------------ |
| Aethopyga saturata | (none) | ------------------------------ |
| Aethopyga siparaja | (none) | ------------------------------ |
| Alauda gulgula | (none) | TAAATTGCCATCTTTTGAAAAAACACCCTC |
| Alcippe nipalensis | (none) | ------------------------------ |
| Alophoixus flaveolus | (none) | ------------------------------ |
| Amandava amandava | (none) | ------------------------------ |
| Ammomanes deserti | (none) | ------------------------------ |
| Ammomanes phoenicurus | (none) | ------------------------------ |
| Anthus hodgsoni | (none) | ------------------------------ |
| Anthus roseatus | (none) | ------------------------------ |
| Anthus rufulus | (none) | ------------------------------ |
| Anthus similis | (none) | ------------------------------ |
| Anthus sylvanus | (none) | ------------------------------ |
| Anthus trivialis | (none) | ------------------------------ |
| Arachnothera longirostra | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Arachnothera magna | (none) | ------------------------------ |
| Artamus fuscus | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Brachypteryx hyperythra | (none) | ------------------------------ |
| Brachypteryx leucophrys | (none) | ------------------------------ |
| Brachypteryx montana | (none) | ------------------------------ |
| Bradypterus luteoventris | (none) | TAAATTGCGATCATTTGAAAAGACACCCTC |
| Bradypterus major | (none) | ------------------------------ |
| Bradypterus mandelli | (none) | ------------------------------ |
| Bradypterus thoracicus | (none) | ------------------------------ |
| Bucanetes mongolicus | (none) | ------------------------------ |
| Calandrella acutirostris | (none) | TAAATTGCCATCTTTTGAAAAAACACCCTC |
| Calandrella raytal | (none) | TAAATTGCCATCTTTTGAAAAAACACCCTC |
| Callacanthis burtoni | (none) | ------------------------------ |
| Carduelis carduelis | (none) | ------------------------------ |
| Carduelis spinoides | (none) | ------------------------------ |
| Carpodacus edwardsii | (none) | ------------------------------ |
| Carpodacus erythrinus | (none) | ------------------------------ |
| Carpodacus grandis | (none) | ------------------------------ |
| Carpodacus nipalensis | (none) | ------------------------------ |
| Carpodacus pulcherrimus | (none) | ------------------------------ |
| Carpodacus rhodochlamys | (none) | ------------------------------ |
| Carpodacus rodochroa | (none) | ------------------------------ |
| Carpodacus rodopeplus | (none) | ------------------------------ |
| Carpodacus rubescens | (none) | ------------------------------ |
| Carpodacus rubicilloides | (none) | ------------------------------ |
| Carpodacus severtzovi | (none) | ------------------------------ |
| Carpodacus thura | (none) | ------------------------------ |
| Carpodacus vinaceus | (none) | ------------------------------ |
| Cephalopyrus flammiceps | (none) | ------------------------------ |
| Cercomela fusca | (none) | ------------------------------ |
| Certhia discolor | (none) | ------------------------------ |
| Certhia familiaris | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Certhia himalayana | (none) | ------------------------------ |
| Certhia nipalensis | (none) | ------------------------------ |
| Cettia brunnescens | (none) | ------------------------------ |
| Cettia brunnifrons | (none) | TAAACTGCCATCATTTGAAAAAACACCCTC |
| Cettia flavolivacea | (none) | ------------------------------ |
| Cettia fortipes | (none) | ------------------------------ |
| Cettia major | (none) | ------------------------------ |
| Cettia pallidipes | (none) | ------------------------------ |
| Chaetornis striata | (none) | ------------------------------ |
| Chaimarrornis leucocephalus | (none) | ------------------------------ |
| Chalcoparia singalensis | (none) | ------------------------------ |
| Chelidorhynx hypoxantha | (none) | ------------------------------ |
| Chloropsis aurifrons | (none) | ------------------------------ |
| Chloropsis hardwickii | (none) | ------------------------------ |
| Chlorospingus ophthalmicus | (none) | ------------------------------ |
| Chlorospingus pileatus | (none) | ------------------------------ |
| Chrysomma sinense | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Cinclidium frontale | (none) | ------------------------------ |
| Cinclus cinclus | (none) | TAAATTGCGATCGTTTGAAAAGACACCCTC |
| Cinclus pallasii | (none) | TAAATTGCGATCATTTGAAAAGACACCCTC |
| Cinnyris asiaticus | (none) | ------------------------------ |
| Cissa chinensis | (none) | ------------------------------ |
| Cisticola exilis | (none) | ------------------------------ |
| Cisticola juncidis | (none) | ------------------------------ |
| Cochoa purpurea | (none) | ------------------------------ |
| Cochoa viridis | (none) | ------------------------------ |
| Coloeus monedula | (none) | ------------------------------ |
| Conostoma oemodium | (none) | ------------------------------ |
| Copsychus malabaricus | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Copsychus saularis | (none) | ------------------------------ |
| Coracina macei | (none) | ------------------------------ |
| Coracina melanoptera | (none) | ------------------------------ |
| Coracina melaschistos | (none) | ------------------------------ |
| Corvus corax | (none) | ------------------------------ |
| Corvus corone | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Corvus culminatus | (none) | ------------------------------ |
| Corvus japonensis | (none) | ------------------------------ |
| Corvus splendens | (none) | ------------------------------ |
| Culicicapa ceylonensis | (none) | TAAATTGCGATCATTTGAAAAAGCACCCTC |
| Cutia nipalensis | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Cyanocompsa parellina | (none) | ------------------------------ |
| Cyanocorax yncas | (none) | ------------------------------ |
| Cyornis magnirostris | (none) | ------------------------------ |
| Cyornis poliogenys | (none) | ------------------------------ |
| Cyornis rubeculoides | (none) | ------------------------------ |
| Cyornis tickelliae | (none) | ------------------------------ |
| Cyornis unicolor | (none) | ------------------------------ |
| Delichon dasypus | (none) | ------------------------------ |
| Delichon nipalense | (none) | ------------------------------ |
| Delichon urbicum | (none) | ------------------------------ |
| Dendrocitta formosae | (none) | ------------------------------ |
| Dendrocitta frontalis | (none) | ------------------------------ |
| Dendrocitta vagabunda | (none) | ------------------------------ |
| Dicaeum agile | (none) | ------------------------------ |
| Dicaeum chrysorrheum | (none) | ------------------------------ |
| Dicaeum cruentatum | (none) | ------------------------------ |
| Dicaeum erythrorhynchos | (none) | ------------------------------ |
| Dicaeum ignipectus | (none) | ------------------------------ |
| Dicaeum melanoxanthum | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Dicaeum minullum | (none) | ------------------------------ |
| Dicrurus aeneus | (none) | ------------------------------ |
| Dicrurus annectans | (none) | ------------------------------ |
| Dicrurus caerulescens | (none) | ------------------------------ |
| Dicrurus hottentottus | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Dicrurus leucophaeus | (none) | ------------------------------ |
| Dicrurus macrocercus | (none) | ------------------------------ |
| Dicrurus paradiseus | (none) | ------------------------------ |
| Dicrurus remifer | (none) | ------------------------------ |
| Dryonastes caerulatus | (none) | ------------------------------ |
| Dryonastes gularis | (none) | ------------------------------ |
| Dryonastes ruficollis | (none) | ------------------------------ |
| Dumetia hyperythra | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Emberiza buchanani | (none) | ------------------------------ |
| Emberiza cia | (none) | ------------------------------ |
| Emberiza fucata | (none) | TAAATTGCGATCATTTGAAAAAACAGCCTC |
| Emberiza godlewskii | (none) | ------------------------------ |
| Emberiza stewarti | (none) | ------------------------------ |
| Enicurus immaculatus | (none) | ------------------------------ |
| Enicurus leschenaulti | (none) | ------------------------------ |
| Enicurus maculatus | (none) | ------------------------------ |
| Enicurus schistaceus | (none) | ------------------------------ |
| Enicurus scouleri | (none) | ------------------------------ |
| Eremophila alpestris | (none) | -------------------AAAACACCCTC |
| Eremopterix griseus | (none) | ------------------------------ |
| Eremopterix nigriceps | (none) | ------------------------------ |
| Erpornis zantholeuca | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Eumyias thalassinus | (none) | ------------------------------ |
| Euodice malabarica | (none) | ------------------------------ |
| Ficedula hyperythra | (none) | ------------------------------ |
| Ficedula monileger | (none) | TAAATTGCCATCATTTGAAAAAACACCCTC |
| Ficedula sapphira | (none) | ------------------------------ |
| Ficedula strophiata | (none) | ------------------------------ |
| Ficedula subrubra | (none) | ------------------------------ |
| Ficedula superciliaris | (none) | ------------------------------ |
| Ficedula tricolor | (none) | ------------------------------ |
| Ficedula westermanni | (none) | ------------------------------ |
| Fringilla montifringilla | (none) | TAAATTGCGATCATTTGAAAAAACAGCCTC |
| Fulvetta ludlowi | (none) | ------------------------------ |
| Fulvetta vinipectus | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Galerida cristata | (none) | TAAATTGCCATCTTTTGAAAAAACACCC{C |
| Gampsorhynchus rufulus | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Garrulax albogularis | (none) | ------------------------------ |
| Garrulax leucolophus | (none) | CAAATTGCGATCATTTGAAAAAACACCTTC |
| Garrulax monileger | (none) | ------------------------------ |
| Garrulax pectoralis | (none) | ------------------------------ |
| Garrulus glandarius | (none) | ------------------------------ |
| Garrulus lanceolatus | (none) | ------------------------------ |
| Gracula religiosa | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Gracupica contra | (none) | ------------------------------ |
| Grammatoptila striata | (none) | ------------------------------ |
| Grandala coelicolor | (none) | ------------------------------ |
| Haematospiza sipahi | (none) | ------------------------------ |
| Hemipus picatus | (none) | TAAATTGCGACCATTTGAAAAAACACCCTC |
| Hemixos flavala | (none) | ------------------------------ |
| Heterophasia annectans | (none) | ------------------------------ |
| Heterophasia capistrata | (none) | ------------------------------ |
| Heterophasia picaoides | (none) | ------------------------------ |
| Heterophasia pulchella | (none) | ------------------------------ |
| Heteroxenicus stellatus | (none) | ------------------------------ |
| Hirundo daurica | (none) | ------------------------------ |
| Hirundo fluvicola | (none) | ------------------------------ |
| Hirundo rustica | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Hirundo smithii | (none) | ------------------------------ |
| Hodgsonius phaenicuroides | (none) | ------------------------------ |
| Hypothymis azurea | (none) | ------------------------------ |
| Hypsipetes leucocephalus | (none) | ------------------------------ |
| Hypsipetes mcclellandi | (none) | ------------------------------ |
| Ianthocincla ocellata | (none) | ------------------------------ |
| Ianthocincla rufogularis | (none) | ------------------------------ |
| Irena puella | (none) | ------------------------------ |
| Lanius meridionalis | (none) | ------------------------------ |
| Lanius schach | (none) | ------------------------------ |
| Lanius tephronotus | (none) | ------------------------------ |
| Lanius vittatus | (none) | ------------------------------ |
| Leiothrix argentauris | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Leiothrix lutea | (none) | ------------------------------ |
| Leptopoecile sophiae | (none) | ------------------------------ |
| Leucosticte brandti | (none) | ------------------------------ |
| Leucosticte nemoricola | (none) | ------------------------------ |
| Liocichla bugunorum | (none) | ------------------------------ |
| Liocichla phoenicea | (none) | ------------------------------ |
| Lioparus chrysotis | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Lonchura atricapilla | (none) | ------------------------------ |
| Lonchura punctulata | (none) | ------------------------------ |
| Lonchura striata | (none) | ------------------------------ |
| Loxia curvirostra | (none) | ------------------------------ |
| Luscinia brunnea | (none) | ------------------------------ |
| Luscinia pectoralis | (none) | ------------------------------ |
| Luscinia svecica | (none) | ------------------------------ |
| Macronous gularis | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Malacocincla abbotti | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Megalurus palustris | (none) | TAAATTGCGATCAGTTGAAAAAACACCCTC |
| Melanochlora sultanea | (none) | TAAATTGCCATCATTTGAAAAAACACCCTC |
| Melanocorypha maxima | (none) | ------------------------------ |
| Melophus lathami | (none) | ------------------------------ |
| Minla cyanouroptera | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Minla ignotincta | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Minla strigula | (none) | ------------------------------ |
| Mirafra assamica | (none) | ------------------------------ |
| Mirafra erythroptera | (none) | TAAATTGCCATCTTTTGAAAAAACACCCTC |
| Monticola cinclorhynchus | (none) | ------------------------------ |
| Monticola rufiventris | (none) | ------------------------------ |
| Monticola solitarius | (none) | ------------------------------ |
| Montifringilla adamsi | (none) | ------------------------------ |
| Montifringilla blanfordi | (none) | ------------------------------ |
| Montifringilla taczanowskii | (none) | ------------------------------ |
| Motacilla alba | (none) | ------------------------------ |
| Motacilla cinerea | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Motacilla citreola | (none) | ------------------------------ |
| Motacilla maderaspatensis | (none) | ------------------------------ |
| Muscicapa dauurica | (none) | ------------------------------ |
| Muscicapa ferruginea | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Muscicapa ruficauda | (none) | ------------------------------ |
| Muscicapa sibirica | (none) | ------------------------------ |
| Muscicapella hodgsoni | (none) | ------------------------------ |
| Myadestes obscurus | (none) | ------------------------------ |
| Myadestes unicolor | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Mycerobas affinis | (none) | ------------------------------ |
| Mycerobas carnipes | (none) | ------------------------------ |
| Mycerobas icterioides | (none) | ------------------------------ |
| Mycerobas melanozanthos | (none) | ------------------------------ |
| Myiomela leucura | (none) | ------------------------------ |
| Myophonus caeruleus | (none) | ------------------------------ |
| Myzornis pyrrhoura | (none) | ------------------------------ |
| Napothera epilepidota | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Niltava grandis | (none) | ------------------------------ |
| Niltava macgrigoriae | (none) | ------------------------------ |
| Niltava sundara | (none) | ------------------------------ |
| Nucifraga caryocatactes | (none) | ------------------------------ |
| Nucifraga multipunctata | (none) | ------------------------------ |
| Oenanthe albonigra | (none) | ------------------------------ |
| Oenanthe deserti | (none) | TAAATTGCCATCATTTGAAAAAACACCCTC |
| Oenanthe picata | (none) | ------------------------------ |
| Oenanthe pleschanka | (none) | ------------------------------ |
| Oreothlypis celata | (none) | ------------------------------ |
| Oreothlypis ruficapilla | (none) | ------------------------------ |
| Oriolus kundoo | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Oriolus tenuirostris | (none) | ------------------------------ |
| Oriolus traillii | (none) | ------------------------------ |
| Oriolus xanthornus | (none) | ------------------------------ |
| Orthotomus sutorius | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Paradoxornis atrosuperciliaris | (none) | ------------------------------ |
| Paradoxornis flavirostris | (none) | ------------------------------ |
| Paradoxornis fulvifrons | (none) | ------------------------------ |
| Paradoxornis gularis | (none) | TAAATTGCGGTCATTTGAAAAAACACCCTC |
| Paradoxornis nipalensis | (none) | TAAATTGCGGTCATTTGAAAAAAAACCCTC |
| Paradoxornis ruficeps | (none) | ------------------------------ |
| Paradoxornis unicolor | (none) | ------------------------------ |
| Parus ater | (none) | ------------------------------ |
| Parus dichrous | (none) | ------------------------------ |
| Parus major | (none) | TAAATTGCCATCATTTGAAAAAACACCCTC |
| Parus melanolophus | (none) | ------------------------------ |
| Parus monticolus | (none) | ------------------------------ |
| Parus rubidiventris | (none) | ------------------------------ |
| Parus rufonuchalis | (none) | ------------------------------ |
| Parus spilonotus | (none) | ------------------------------ |
| Parus xanthogenys | (none) | ------------------------------ |
| Passer domesticus | (none) | ------------------------------ |
| Passer montanus | (none) | ------------------------------ |
| Passer rutilans | (none) | ------------------------------ |
| Passerina cyanea | (none) | ------------------------------ |
| Pellorneum albiventre | (none) | ------------------------------ |
| Pellorneum ruficeps | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Pellorneum tickelli | (none) | ------------------------------ |
| Pericrocotus brevirostris | (none) | ------------------------------ |
| Pericrocotus cinnamomeus | (none) | ------------------------------ |
| Pericrocotus ethologus | (none) | TAAATTGCGATCATTTGAGAAAACACCCTC |
| Pericrocotus roseus | (none) | ------------------------------ |
| Pericrocotus solaris | (none) | ------------------------------ |
| Pericrocotus speciosus | (none) | ------------------------------ |
| Petronia xanthocollis | (none) | ------------------------------ |
| Phoenicurus coeruleocephala | (none) | ------------------------------ |
| Phoenicurus erythrogastrus | (none) | ------------------------------ |
| Phoenicurus frontalis | (none) | TAAATTGCGATCATTTGAAAAAACACCCT? |
| Phoenicurus ochruros | (none) | ------------------------------ |
| Phoenicurus schisticeps | (none) | ------------------------------ |
| Phyllergates cucullatus | (none) | ------------------------------ |
| Phylloscopus affinis | (none) | ------------------------------ |
| Phylloscopus cantator | (none) | ------------------------------ |
| Phylloscopus chloronotus | (none) | ------------------------------ |
| Phylloscopus fuligiventer | (none) | ------------------------------ |
| Phylloscopus griseolus | (none) | ------------------------------ |
| Phylloscopus humei | (none) | ------------------------------ |
| Phylloscopus maculipennis | (none) | ------------------------------ |
| Phylloscopus magnirostris | (none) | ------------------------------ |
| Phylloscopus occipitalis | (none) | ------------------------------ |
| Phylloscopus pulcher | (none) | ------------------------------ |
| Phylloscopus reguloides | (none) | ------------------------------ |
| Phylloscopus sindianus | (none) | ----------------------------TC |
| Phylloscopus subviridis | (none) | ------------------------------ |
| Phylloscopus trochiloides | (none) | ------------------------------ |
| Phylloscopus tytleri | (none) | ------------------------------ |
| Phylloscopus xanthoschistos | (none) | ------------------------------ |
| Pica pica | (none) | ------------------------------ |
| Pitta brachyura | (none) | ------------------------------ |
| Pitta nipalensis | (none) | ------------------------------ |
| Pitta sordida | (none) | TAAAGTGCGACCATTTGAAAAAACGCCCTC |
| Ploceus benghalensis | (none) | ------------------------------ |
| Ploceus manyar | (none) | ------------------------------ |
| Ploceus megarhynchus | (none) | ------------------------------ |
| Ploceus philippinus | (none) | ------------------------------ |
| Pnoepyga albiventer | (none) | TAAATTACGATCATTTGAAAAAACACCCTC |
| Pnoepyga immaculata | (none) | ------------------------------ |
| Pnoepyga pusilla | (none) | TAAATTACGATCATTTGAAAAAACACCCTC |
| Pomarea dimidiata | (none) | ------------------------------ |
| Pomarea iphis | (none) | ------------------------------ |
| Pomatorhinus erythrocnemis | (none) | ------------------------------ |
| Pomatorhinus erythrogenys | (none) | ------------------------------ |
| Pomatorhinus ferruginosus | (none) | ------------------------------ |
| Pomatorhinus hypoleucos | (none) | ------------------------------ |
| Pomatorhinus ruficollis | (none) | ------------------------------ |
| Pomatorhinus schisticeps | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Prinia atrogularis | (none) | ------------------------------ |
| Prinia buchanani | (none) | ------------------------------ |
| Prinia burnesii | (none) | ------------------------------ |
| Prinia cinereocapilla | (none) | ------------------------------ |
| Prinia crinigera | (none) | ------------------------------ |
| Prinia flaviventris | (none) | ------------------------------ |
| Prinia gracilis | (none) | ------------------------------ |
| Prinia hodgsonii | (none) | ------------------------------ |
| Prinia inornata | (none) | ------------------------------ |
| Prinia rufescens | (none) | ------------------------------ |
| Prinia socialis | (none) | ------------------------------ |
| Prinia sylvatica | (none) | ------------------------------ |
| Propyrrhula subhimachala | (none) | ------------------------------ |
| Prunella collaris | (none) | ------------------------------ |
| Prunella fulvescens | (none) | ------------------------------ |
| Prunella immaculata | (none) | ------------------------------ |
| Prunella rubeculoides | (none) | ------------------------------ |
| Prunella strophiata | (none) | ------------------------------ |
| Psarisomus dalhousiae | (none) | TAAAGTGCGAACATTTAAAAAAACACCCTC |
| Pseudopodoces humilis | (none) | ------------------------------ |
| Pteruthius flaviscapis | (none) | ------------------------------ |
| Pteruthius melanotis | (none) | ----TTGCGATCATTTGAAAAAACACCCTC |
| Pteruthius rufiventer | (none) | ------------------------------ |
| Pteruthius xanthochlorus | (none) | --AATTGCGATCATTTGAAAAAACACCCTC |
| Ptyonoprogne concolor | (none) | ------------------------------ |
| Ptyonoprogne rupestris | (none) | ------------------------------ |
| Pycnonotus cafer | (none) | ------------------------------ |
| Pycnonotus flaviventris | (none) | ------------------------------ |
| Pycnonotus jocosus | (none) | ------------------------------ |
| Pycnonotus leucogenys | (none) | ------------------------------ |
| Pycnonotus striatus | (none) | ------------------------------ |
| Pyrrhocorax graculus | (none) | ------------------------------ |
| Pyrrhocorax pyrrhocorax | (none) | ------------------------------ |
| Pyrrhoplectes epauletta | (none) | ------------------------------ |
| Pyrrhospiza punicea | (none) | ------------------------------ |
| Pyrrhula aurantiaca | (none) | ------------------------------ |
| Pyrrhula erythaca | (none) | ------------------------------ |
| Pyrrhula erythrocephala | (none) | ------------------------------ |
| Pyrrhula nipalensis | (none) | ------------------------------ |
| Regulus regulus | (none) | TAAATTACGATCATTTGAAAAAACACACTC |
| Rhipidura albicollis | (none) | TAAATTGCGATCATTTGAAAAAACACCTCT |
| Rhipidura aureola | (none) | ------------------------------ |
| Rhyacornis fuliginosa | (none) | ------------------------------ |
| Rimator malacoptilus | (none) | ------------------------------ |
| Riparia chinensis | (none) | ------------------------------ |
| Saroglossa spiloptera | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Saxicola caprata | (none) | ------------------------------ |
| Saxicola ferreus | (none) | ------------------------------ |
| Saxicola jerdoni | (none) | ------------------------------ |
| Saxicola leucurus | (none) | ------------------------------ |
| Saxicola torquatus | (none) | ------------------------------ |
| Saxicoloides fulicatus | (none) | ------------------------------ |
| Schoeniparus castaneceps | (none) | ------------------------------ |
| Schoeniparus cinerea | (none) | ------------------------------ |
| Schoeniparus dubia | (none) | ------------------------------ |
| Schoeniparus rufogularis | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Seicercus affinis | (none) | ------------------------------ |
| Seicercus burkii | (none) | ------------------------------ |
| Seicercus castaniceps | (none) | ------------------------------ |
| Seicercus poliogenys | (none) | ------------------------------ |
| Seicercus whistleri | (none) | ------------------------------ |
| Serilophus lunatus | (none) | TAAAGTGCGAACATCTGAAAAAACACCCTC |
| Serinus pusillus | (none) | ------------------------------ |
| Sitta cashmirensis | (none) | ------------------------------ |
| Sitta cinnamoventris | (none) | ------------------------------ |
| Sitta formosa | (none) | ------------------------------ |
| Sitta frontalis | (none) | ------------------------------ |
| Sitta himalayensis | (none) | ------------------------------ |
| Sitta leucopsis | (none) | ------------------------------ |
| Spelaeornis caudatus | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Spelaeornis formosus | (none) | ------------------------------ |
| Spelaeornis troglodytoides | (none) | ------------------------------ |
| Sphenocichla humei | (none) | ------------------------------ |
| Stachyridopsis chrysaea | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Stachyridopsis pyrrhops | (none) | ------------------------------ |
| Stachyridopsis ruficeps | (none) | ------------------------------ |
| Stachyridopsis rufifrons | (none) | ------------------------------ |
| Stachyris nigriceps | (none) | CAAATTGCGATCATTTGAAAAAACACCCTC |
| Staphida castaniceps | (none) | ------------------------------ |
| Sturnella magna | (none) | ------------------------------ |
| Sturnella neglecta | (none) | ------------------------------ |
| Sturnia malabarica | (none) | ------------------------------ |
| Sturnus vulgaris | (none) | TAAATTGCCATCATTTGAAAAAACACCCTC |
| Sylvia althaea | (none) | ------------------------------ |
| Sylvia melanothorax | (none) | ------------------------------ |
| Sylvia rueppelli | (none) | ------------------------------ |
| Sylviparus modestus | (none) | ------------------------------ |
| Tangara dowii | (none) | ------------------------------ |
| Tangara nigroviridis | (none) | ------------------------------ |
| Tarsiger chrysaeus | (none) | ------------------------------ |
| Tarsiger hyperythrus | (none) | ------------------------------ |
| Tarsiger indicus | (none) | ------------------------------ |
| Tarsiger rufilatus | (none) | ------------------------------ |
| Temenuchus pagodarum | (none) | ------------------------------ |
| Tephrodornis gularis | (none) | TAAATTGCGACCATTTGAAAAAACACCCTC |
| Tephrodornis pondicerianus | (none) | ------------------------------ |
| Terpsiphone paradisi | (none) | ------------------------------ |
| Tesia castaneocoronata | (none) | ------------------------------ |
| Tesia cyaniventer | (none) | ------------------------------ |
| Tesia olivea | (none) | ------------------------------ |
| Tichodroma muraria | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Tickellia hodgsoni | (none) | ------------------------------ |
| Timalia pileata | (none) | ------------------------------ |
| Trochalopteron affine | (none) | ------------------------------ |
| Trochalopteron erythrocephalum | (none) | CAAACTGAGATCATTTGAAAAAACACCCTC |
| Trochalopteron imbricatum | (none) | ------------------------------ |
| Trochalopteron lineatum | (none) | ------------------------------ |
| Trochalopteron squamatum | (none) | ------------------------------ |
| Trochalopteron subunicolor | (none) | ------------------------------ |
| Trochalopteron variegatum | (none) | ------------------------------ |
| Troglodytes troglodytes | (none) | ------------------------------ |
| Turdoides caudata | (none) | ------------------------------ |
| Turdoides earlei | (none) | ------------------------------ |
| Turdoides longirostris | (none) | ------------------------------ |
| Turdoides malcolmi | (none) | ------------------------------ |
| Turdoides nipalensis | (none) | ------------------------------ |
| Turdoides striata | (none) | ------------------------------ |
| Turdus albocinctus | (none) | ------------------------------ |
| Turdus boulboul | (none) | ------------------------------ |
| Turdus maximus | (none) | ------------------------------ |
| Turdus rubrocanus | (none) | ------------------------------ |
| Turdus unicolor | (none) | ------------------------------ |
| Turdus viscivorus | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Urocissa erythrorhyncha | (none) | ------------------------------ |
| Urocissa flavirostris | (none) | ------------------------------ |
| Xiphirhynchus superciliaris | (none) | ------------------------------ |
| Yuhina bakeri | (none) | ------------------------------ |
| Yuhina flavicollis | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Yuhina gularis | (none) | TAAATTGCGATCATTTGAAAAAACACCCT{ |
| Yuhina nigrimenta | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Yuhina occipitalis | (none) | ------------------------------ |
| Zonotrichia albicollis | (none) | ------------------------------ |
| Zonotrichia atricapilla | (none) | ------------------------------ |
| Zoothera citrina | (none) | ------------------------------ |
| Zoothera dauma | (none) | TAAATTGCGATCATTTGAAAAAACACCCTC |
| Zoothera dixoni | (none) | ------------------------------ |
| Zoothera marginata | (none) | ------------------------------ |
| Zoothera mollissima | (none) | ------------------------------ |
| Zoothera monticola | (none) | ------------------------------ |
| Zoothera wardii | (none) | ------------------------------ |
| Zosterops palpebrosus | (none) | ------------------------------ |
Columns
None of the columns has a description.