Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 10875 of Study 1428
Citation title: "A new poroid species of Resupinatus from Puerto Rico, with a reassessment of the cyphelloid genus Stigmatolemma".
This study was previously identified under the legacy study ID S1363
(Status: Published).
Matrices
Title: Lophotrochozoa: 7,537 nucleotide positions
Description: Maximum likelihood
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Microcotyle sebastis | (none) | --AT-------------------------- |
| Echinococcus granulosus | (none) | --ATGTGT---------------------- |
| Schistosoma japonicum | (none) | --ATTTTCGGTTTG---------------- |
| Caenorhabditis elegans | (none) | --ATAACAGTTATT---------------- |
| Trichinella spiralis | (none) | ATACCTCTACATTTACCTACAAGCAACCTC |
| Spadella cephaloptera | (none) | ?????????????????????????????? |
| Paraspadella gotoi | (none) | ?????????????????????????????? |
| Terebratulina retusa | (none) | --ATCTAGGAATTT---------------- |
| Laqueus rubellus | (none) | --ATTTGGGATTTT---------------- |
| Terebratalia transversa | (none) | ----TTGCGATTTT---------------- |
| Flustrellidra hispida | (none) | --ATCTTTGATTTT---------------- |
| Watersipora subtorquata | (none) | --ATGCCTGAATTT---------------- |
| Bugula neritina | (none) | --ATGCATGAATTT---------------- |
| Flustra foliacea | (none) | --ATGCTTGAATTT---------------- |
| Nautilus macromphalus | (none) | --ATCTTCGAATTT---------------- |
| Octopus vulgaris | (none) | --ATATGTGAATTT---------------- |
| Loligo bleekeri | (none) | AGATATGTGAATTT---------------- |
| Biomphalaria glabrata | (none) | --ATTTACGACTTT---------------- |
| Aplysia californica | (none) | --ATATAGGACTTT---------------- |
| Pupa strigosa | (none) | --ATCAGCGATTTT---------------- |
| Graptacme eborea | (none) | --ATCTATGAATTT---------------- |
| Katharina tunicata | (none) | --ATATATGAATTT---------------- |
| Cephalothrix simula | (none) | --ATTTATGAATTT---------------- |
| Lineus viridis | (none) | --ATCTATGAATTT---------------- |
| Loxosomella aloxiata | (none) | GTATTTGTGAATTT---------------- |
| Loxocorone allax | (none) | ATATTTGTGAATTT---------------- |
| Phoronis psammophila | (none) | --ATATGCGAATTT---------------- |
| Platynereis dumerilii | (none) | --ATATCTGAATTT---------------- |
| Clymenella torquata | (none) | --ATCTACGAATTT---------------- |
| Urechis caupo | (none) | --ATCTCCGAATTT---------------- |
| Lumbricus terrestris | (none) | --ATATCCGAATTT---------------- |
| Sipunculus nudus | (none) | --ATCTATGATTTT---------------- |
| Homo sapiens | (none) | --ATAAGAAACTTT---------------- |
| Xenopus laevis | (none) | --ATAACTAGTTTT---------------- |
| Balanoglossus carnosus | (none) | --ATAACTAGCTTT---------------- |
| Florometra serratissima | (none) | GTATTTAATCATTT---------------- |
| Arbacia lixula | (none) | ATTTAAGCAGATTT---------------- |
| Acropora tenuis | (none) | --ATAGGGGCTATT---------------- |
| Metridium senile | (none) | --ATGGGCGCTATT---------------- |
| Priapulus caudatus | (none) | --ATATAGGGTTTT---------------- |
| Epiperipatus biolleyi | (none) | --ATATATAGTTTT---------------- |
| Triops cancriformis | (none) | --ATATACAACTTT---------------- |
| Antrokoreana gracilipes | (none) | --ATATGGAACTTT---------------- |
| Lithobius forficatus | (none) | --ATATACAATTTT---------------- |
| Heptathela hangzhouensis | (none) | --ATATATAATTTT---------------- |
| Limulus polyphemus | (none) | --ATATACAACTTT---------------- |
| Penaeus monodon | (none) | --ATATACAATTTT---------------- |
| Tribolium castaneum | (none) | --ATATGCAACTTT---------------- |
| Atelura formicaria | (none) | --ATATACAACTTT---------------- |
Columns
None of the columns has a description.
