@ARTICLE{TreeBASE2Ref16016,
	 author = {L. A.  Johnson and R. L.  Johnson},
	 title = {Morphological delimitation and molecular evidence for allopolyploidy in Collomia wilkenii (Polemoniaceae), a new species from northern Nevada},
	 year = {2006},
	 keywords = {},
	 doi = {},
	 url = {},
	 pmid = {},
	 journal = {Systematic Botany},
	 volume = {},
	 number = {},
	 pages = {},
	 abstract = {Under the criterion of limited homogenizing gene flow as evidenced through specimen aggregation analysis, and genetic evidence of a barrier to gene exchange with its closest relatives, we describe a new species in Polemoniaceae, Collomia wilkenii. Collomia wilkenii superficially resembles Collomia tinctoria and Collomia linearis in some features, but, upon examination, has consistent, unique character combinations that distinguish it from both species, as well as Collomia renacta and Collomia tenella. These features include particulars of calyx morphology, corolla morphology, stamen insertion and exertion, numbers of flowers in inflorescence clusters, and the kinds and distribution of glandular and eglandular trichomes. Comparative DNA sequencing of chloroplast genes indicates Collomia wilkenii has the chloroplast genome of Collomia tenella. Nuclear ITS sequences show additivity in Collomia wilkenii between Collomia linearis and Collomia tenella, a pattern confirmed by cloning this region. Two low copy nuclear loci, idh-A and idh-B, indicate an allopolyploid origin of this previously undescribed species. Collomia wilkenii is endemic to northern Nevada, occuring in several remote locations across the breadth of the state.}
}
Matrix 962 of  Study 1445
	
	
		
		Citation title: 
"Morphological delimitation and molecular evidence for allopolyploidy in Collomia wilkenii (Polemoniaceae), a new species from northern Nevada".
	
 
	
		
			
	
			This study was previously identified under the legacy study ID S1380  
			(Status: Published).
		
 
	
	
 
Matrices
	Title: Matrix 5 idhB
	Description: Legacy TreeBASE Matrix ID = M2456
	
	
	
	
	
	
	
	
	
	
	
Rows
| 
Taxon Label | 
Row Segments | 
Characters 1?–30 | 
| Collomia wilkenii NV1c T | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia wilkenii NV1c L | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia tinctoria | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTTACTCTCTC | 
| Collomia tenella UT | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia tenella NV | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia renacta | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia linearis UT | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia linearis NV | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia grandiflora | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia cavanillesii ARG L | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
| Collomia cavanillesii ARG G | 
		
	
					 (none)
				
		
	 | 
TAAGTAAGTTTGTTAAGGAGTT--TCTCTC | 
Columns
None of the columns has a description.