@ARTICLE{TreeBASE2Ref22954,
author = {Bo Li and Mieczyslaw Wolsan and Dan Wu and Wei Zhang and Yanchun Xu and Zhaohui Zeng},
title = {Mitochondrial genomes reveal the pattern and timing of marten (Martes), wolverine (Gulo), and fisher (Pekania) diversification},
year = {2014},
keywords = {Divergence time; Evolution; Guloninae; Mitogenomics; Mustelidae; Phylogeny},
doi = {10.1016/j.ympev.2014.08.002},
url = {http://},
pmid = { 4986},
journal = {Molecular Phylogenetics and Evolution},
volume = {80},
number = {},
pages = {156--164},
abstract = {Despite recent advances in understanding the pattern and timescale of evolutionary
diversification in the marten, wolverine, fisher, and tayra subfamily Guloninae (Mustelidae,
Carnivora), several important issues still remain contentious. Among these are the phylogenetic
position of Gulo relative to the subgenera of Martes (Martes and Charronia), the phylogenetic
relationships within the subgenus Martes, and the timing of gulonine divergences. To elucidate
these issues we explored nucleotide variation in 11 whole mitochondrial genomes (mitogenomes)
from eight gulonine species and two outgroup meline species. Parsimony, maximum likelihood,
and Bayesian phylogenetic analyses yielded fully resolved and identical patterns of relationships
with high support for all divergences. The generic status of Pekania (P. pennanti), the monophyly
of the genus Martes containing M. flavigula (subgenus Charronia) to the exclusion of the genus
Gulo (G. gulo), and the M. foina (M. americana (M. melampus (M. zibellina, M. martes)))
phylogeny of the subgenus Martes were strongly supported. Dating analyses (BEAST) using a set
of five newly applied fossil calibrations provided divergence times considerably younger than
previous multigene mitochondrial estimates, but similar to multigene nuclear and nuclear?
mitochondrial estimates. The 95% confidence (highest posterior density) intervals of our
divergence times fell within those inferred from nuclear and nuclear?mitochondrial sequence
data, and were markedly narrower than in earlier studies (whether nuclear, mitochondrial, or
combined). Notably, and contrary to long-held beliefs, our findings indicate that fossils older than
the Tortonian?Messinian transition (late Late Miocene) do not represent Martes, excluding from
this genus its putative members from the Early, Middle, and early Late Miocene. This study
demonstrates the high informativeness of the mitogenome for phylogenetic inference and
divergence time estimation within Guloninae, and suggests that mitogenomes can be highly
informative also for other clades at similar levels of evolutionary divergence.}
}
Matrix 23664 of Study 14535

Citation title:
"Mitochondrial genomes reveal the pattern and timing of marten (Martes), wolverine (Gulo), and fisher (Pekania) diversification".

Study name:
"Mitochondrial genomes reveal the pattern and timing of marten (Martes), wolverine (Gulo), and fisher (Pekania) diversification".

This study is part of submission 14535
(Status: Published).
Matrices
Title: Guloninae-15475
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Martes zibellina NC 011579 |
(none)
|
GTTAATGTAGCTTATTGAG-TTAAAGCAAG |
Martes zibellina HM106323 |
(none)
|
GTTAATGTAGCTTATTGAG-TTAAAGCAAG |
Martes martes |
(none)
|
GTTAATGTAGCTTATTGAG-TTAAAGCAAG |
Martes americana |
(none)
|
GTTAATGTAGCTTATTGAG-TTAAAGCAAG |
Martes melampus |
(none)
|
GTTAATGTAGCTTATCAAG-TTAAAGCAAG |
Martes foina |
(none)
|
GTTAATGTAGCTTATTAAACTTAAAGCAAG |
Gulo gulo |
(none)
|
GTTAATGTAGCTTATCAAA-TTAAAGCAAG |
Martes flavigula |
(none)
|
GTTAATGTAGCTTATCAAA-TTAAAGCAAG |
Pekania pennanti |
(none)
|
GTTAATGTAGCTTATCAAA--TAAAGCAAG |
Meles meles |
(none)
|
GTTAACGTAGCTTATTAA---TAAAGCGAG |
Meles anakuma |
(none)
|
GTTAACGTAGCTTATTAA---TAAAGCGAG |
Columns
None of the columns has a description.