@ARTICLE{TreeBASE2Ref18270,
author = {Liyun Zeng and Molly W. Jacobs and Billlie J. Swalla},
title = {Coloniality has evolved once in Stolidobranch Ascidians},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Integrative and Comparative Biology},
volume = {},
number = {},
pages = {},
abstract = {Tunicates exhibit a rich array of body plans and life history strategies. Colonial species typically consist of zooids embedded together in a common test and brood large larvae, while solitary species live singly and typically free-spawn eggs which develop into small larvae. Tunicates in the suborder Stolidobranchia contain both colonial and solitary species, as well as several species with intermediate morphologies. These include social species, which are colonial but do not live embedded in a common test, and solitary species which brood or produce large larvae. We completed the most extensive phylogenetic analyses published to date in order to examine how many times coloniality has evolved within the Stolidobranchia, with full length18S rDNA and cytochrome oxidase b sequences of members of the families Molgulidae, Styelidae, Pyuridae, and Botryllidae. As shown previously by analyses from this lab, suborders Phlebobranchia and Stolidobranchia are sister groups, and the family Molgulidae falls out as a monophyletic group and should be raised to the subordinal level. In contrast to previous studies, the Styelids and Pyurids are separated into monophyletic groups by some of the analyses. We show a single clade within the family Styelidae (suborder Stolidobranchia) that contains three colonial (compound) species, the colonial (social) species Metandrocarpa taylori, as well as three solitary species. These results suggest that the ancestor of the Stolidobranchia suborder was solitary and that coloniality has evolved only once within this clade of ascidians. Furthermore, it suggests that the family Botryllidae is correctly classified as a genus within the Styelidae, not a separate family. Further in depth phylogenetic analyses of the remaining orders of ascidians will be necessary to understand the number of times that coloniality may have evolved within the tunicates.}
}
Matrix 1083 of Study 1496

Citation title:
"Coloniality has evolved once in Stolidobranch Ascidians".

This study was previously identified under the legacy study ID S1440
(Status: Published).
Matrices
Title: Tunicates Mitochondrial Cytb partial Gene
Description: Legacy TreeBASE Matrix ID = M2592
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Symplegma viride |
(none)
|
--TTTTTTTTTGTTTGGGGG---GAAATGA |
Styela plicata |
(none)
|
-GTTTTTTTTTGTTTGGGGG---CAAATGA |
Styela montereyensis |
(none)
|
GTTTTTTTTTTGTTTGAGGGCACCATCAGT |
Styela gibbsii |
(none)
|
-GTTTTTTTTTGTTTGAGGGCATCATCAAT |
Pyura haustor |
(none)
|
----GTTTTTT---TGAGGG---CAAAGAG |
Polycarpa pomaria |
(none)
|
GTTTTTTTTTT---TGGGGG---CAAATGA |
Polycarpa papillata |
(none)
|
-TTTTTTTTTT---TGGGGG---CAAATGA |
Metandrocarpa taylori |
(none)
|
-TTTTTTTTTT---TGGGGG---CAAATGA |
Halocynthia roretzi |
(none)
|
-ATTTTTTTTT---TGGGGC---CAAATGA |
Halocynthia igaboja |
(none)
|
--TTTTTTTTT---TGGGGG---CAAATGA |
Doliolum nationalis |
(none)
|
-CGTACTCCCC---TGAGGT---CAAATAA |
Dendrodoa grossularia |
(none)
|
--TTTTTTTTT---TGGGGG---CAAATGA |
Cnemidocarpa finmarkiensis |
(none)
|
-TTTTTTTTTT---TGGGGG---CAAATGA |
Ciona savignyi |
(none)
|
-TGTTTTACCG---TGAGGT---CAGATAA |
Ciona intestinalis |
(none)
|
-TGTTTTACCT---TGAAGA---CAAATAA |
Botryllus schlosseri |
(none)
|
--TTTTTTTTTGTTTGGGGG---GAAATGA |
Botryllus planus |
(none)
|
--TTTTTTTTTGTTTGGGGG---GAAATGA |
Botrylloides violaceus |
(none)
|
--TTTTTTTTTGTTTGGGGG---GAAATGA |
Boltenia villosa |
(none)
|
----GTTTTTT---TGGGGG---CAAAGAG |
Columns
None of the columns has a description.