@ARTICLE{TreeBASE2Ref22796,
author = {Luca Pozzi and Todd R Disotell and Judith C Masters},
title = {A multilocus phylogeny reveals deep lineages within African galagids (Primates: Galagidae)},
year = {2014},
keywords = {Concatenation, species tree, divergence times, nuclear DNA, Eocene-Oligocene boundary, Strepsirhini, Lorisoidea},
doi = {10.1186/1471-2148-14-72},
url = {http://www.biomedcentral.com/1471-2148/14/72},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {14},
number = {},
pages = {72},
abstract = {Background
Bushbabies (Galagidae) are among the most morphologically cryptic of all primates and their diversity and relationships are some of the most longstanding problems in primatology. Our knowledge of galagid evolutionary history has been limited by a lack of appropriate molecular data and a paucity of fossils. Most phylogenetic studies have produced conflicting results for many clades, and even the relationships among genera remain uncertain. To clarify galagid evolutionary history, we assembled the largest molecular dataset for galagos to date by sequencing 27 independent loci. We inferred phylogenetic relationships using concatenated maximum-likelihood (ML) and Bayesian analyses, and also coalescent-based species tree methods to account for gene tree heterogeneity due to incomplete lineage sorting.
Results
The genus Euoticus was identified as sister taxon to the rest of the galagids and the genus Galagoides was not recovered as monophyletic, suggesting that a new generic name for the Zanzibar complex is required. Despite the amount of genetic data collected in this study, the monophyly of the family Lorisidae remained poorly supported, probably due to the short internode between the Lorisidae/Galagidae split and the origin of the African and Asian lorisid clades. One major result was the relatively old origin for the most recent common ancestor of all living galagids soon after the Eocene-Oligocene boundary.
Conclusions
Using a multilocus approach, our results suggest an early origin for the crown Galagidae, soon after the Eocene-Oligocene boundary, making Euoticus one of the oldest lineages within extant Primates. This result also implies that one ? or possibly more ? stem radiations diverged in the Late Eocene and persisted for several million years alongside members of the crown group. }
}
Matrix 21204 of Study 15281

Citation title:
"A multilocus phylogeny reveals deep lineages within African galagids (Primates: Galagidae)".

Study name:
"A multilocus phylogeny reveals deep lineages within African galagids (Primates: Galagidae)".

This study is part of submission 15281
(Status: Published).
Matrices
Title: African Galagids 27 loci complete
Description: Matrix including 27 loci
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Arctocebus calabarensis ACL1 |
(none)
|
?????????????????????????????? |
Chlorocebus aethiops CAE4 |
(none)
|
?????????????????????????????? |
Daubentonia madagascariensis DMD5 |
(none)
|
?????????????????????????????? |
Euoticus elegantulus AMNH269911 |
(none)
|
???TTTCAGCTCTACCTACAGTCCTCTCCT |
Galago matschiei FMNH148985 |
(none)
|
?????????????????????????????? |
Galago moholi ABSHER009f |
(none)
|
?????????????????????????????? |
Galago moholi GMO4 |
(none)
|
?????????????????????????????? |
Galago moholi JCM001 |
(none)
|
?????????????????????????????? |
Galago senegalensis GSE1 |
(none)
|
?????????????????????????????? |
Galagoides cocos GCDN006 |
(none)
|
???????AGCTCTACCTACAGTCCTCTCCT |
Galagoides demidoff 3048f |
(none)
|
TCTTTTCAGCTCTACCTACAGTCCTCTCCT |
Galagoides demidoff AMNH 269853 |
(none)
|
???TTTCAGCTCTACCTACAGTCCCCTCCT |
Galagoides thomasi GTH1 |
(none)
|
?????????????????????????????? |
Galagoides zanzibaricus GZUD002 |
(none)
|
?????????????????????????????? |
Homo sapiens HSA34 |
(none)
|
?????????????????????????????? |
Lemur catta LCT10 |
(none)
|
?????????????????????????????? |
Loris tardigradus LTA2 |
(none)
|
?????????????????????????????? |
Macaca mulatta MMA14 |
(none)
|
?????????????????????????????? |
Nycticebus bengalensis NBE1 |
(none)
|
?????????????????????????????? |
Nycticebus coucang NCO2 |
(none)
|
?????????????????????????????? |
Nycticebus pygmaeus NPY1 |
(none)
|
?????????????????????????????? |
Otolemur crassicaudatus OCR1 |
(none)
|
?????????????????????????????? |
Otolemur garnettii GGR2 |
(none)
|
?????????????????????????????? |
Otolemur garnettii OGDN006 |
(none)
|
????TTCAGCTCTACCTACAGTCCTCTCCT |
Pan troglodytes PTR104 |
(none)
|
?????????????????????????????? |
Papio hamadryas PHM1 |
(none)
|
?????????????????????????????? |
Perodicticus potto PEP2 |
(none)
|
?????????????????????????????? |
Pongo pygmaeus PPY155 |
(none)
|
?????????????????????????????? |
Propithecus verreauxi PVE1 |
(none)
|
?????????????????????????????? |
Theropithecus gelada TGE2 |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.