@ARTICLE{TreeBASE2Ref25193,
author = {Edward Claiborne Theriot and Matt Ashworth and Teofil Nakov and Elizabeth Clare Ruck and Robert K Jansen},
title = {Dissecting signal and noise in diatom chloroplast protein encoding genes with phylogenetic information profiling},
year = {2015},
keywords = {diatom phylogeny, chloroplast genes, 3rd codon position, phylogenetic signal, phylogenetic information profiling, Bremer support},
doi = {10.1016/j.ympev.2015.03.012},
url = {http://dx.doi.org/10.1016/j.ympev.2015.03.012},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {89},
number = {},
pages = {28--36},
abstract = { Previous analyses of single diatom chloroplast protein-encoded genes recovered results highly incongruent with both traditional phylogenies and phylogenies derived from the nuclear encoded small subunit (SSU) gene. Our analysis here of six individual chloroplast genes (atpB, psaA, psaB, psbA, psbC and rbcL) obtained similar anomalous results. However, phylogenetic noise in these genes did not appear to be correlated, and their concatenation appeared to effectively sum their collective signal. We empirically demonstrated the value of combining phylogenetic information profiling, partitioned Bremer support and entropy analysis in examining the utility of various partitions in phylogenetic analysis. Noise was low in the 1st and 2nd codon positions, but so was signal. Conversely, high noise levels in the 3rd codon position was accompanied by high signal. Perhaps counterintuitively, simple exclusion experiments demonstrated this was especially true at deeper nodes where the 3rd codon position contributed most to a result congruent with morphology and SSU (and the total evidence tree here). Correlated with our empirical findings, probability of correct signal (derived from information profiling) increased and the statistical significance of substitutional saturation decreased as data were aggregated. In this regard, the aggregated 3rd codon position performed as well or better than more slowly evolving sites. Simply put, direct methods of noise removal (elimination of fast-evolving sites) disproportionately removed signal. Information profiling and partitioned Bremer support suggest that addition of chloroplast data will rapidly improve our understanding of the diatom phylogeny, but conversely also illustrate that some parts of the diatom tree are likely to remain recalcitrant to addition of molecular data. The methods based on information profiling have been criticized for their numerous assumptions and parameter estimates and the fact that they are based on quartets of taxa. Our empirical results support theoretical arguments that the simplifying assumptions made in these methods are robust to ?real-life? situations.}
}
Matrix 21595 of Study 18390

Citation title:
"Dissecting signal and noise in diatom chloroplast protein encoding genes with phylogenetic information profiling".

Study name:
"Dissecting signal and noise in diatom chloroplast protein encoding genes with phylogenetic information profiling".

This study is part of submission 18390
(Status: Published).
Matrices
Title: Fungi from soda soils ITS Sodiomyces
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Sodiomyces alkalinus F7 |
(none)
|
TAACCCTTATGCGAACCTTTATACCACGTT |
Sodiomyces alkalinus F8 |
(none)
|
TAACCCTTATGCGAACCTTTATACCACGTT |
Sodiomyces alkalinus F10 |
(none)
|
TAACCCTTATGCGAACCTTTATACCACGTT |
Sodiomyces alkalinus F20 |
(none)
|
TAACCCTTATGCGAACCTTTATACCACGTT |
Sodiomyces alkalinus F11 |
(none)
|
TAACCCTTATGCGAACCTTTATACCACGTT |
Sodiomyces alkalinus F12 |
(none)
|
TAACCCTTATGCGAACCTTTATACCACGTT |
Sodiomyces alkalinus F9 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F15 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F16 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F17 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F18 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F19 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F22 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F23 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F14 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F21 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F24 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces alkalinus F13 |
(none)
|
TAACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces tronii MAG1 |
(none)
|
??????????GTGAACCTTTATACCACGTT |
Sodiomyces tronii MAG3 |
(none)
|
??ACCCTTATGTGAACCTTTATACCACGTT |
Sodiomyces magadii MAG2 |
(none)
|
??AACCCTATGTGAACCTGTATACCACGTT |
Acremonium alcalophilum CBS 114 92 |
(none)
|
??????????????ACCTATATACCACGTT |
Columns
None of the columns has a description.