@ARTICLE{TreeBASE2Ref23070,
author = {Wanjun Gu and Musheng Li and Yuming Xu and Ting Wang and Jae-hong Ko and Tong Zhou},
title = {The impact of RNA structure on coding sequence evolution in both bacteria and eukaryotes},
year = {2014},
keywords = {mRNA structure; purifying selection; synonymous mutation; translation initiation; codon usage bias; gene expression},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: Many studies have found functional RNA secondary structures are selectively conserved among species. But, the effect of RNA structure selection on coding sequence evolution remains unknown. To address this problem, we systematically investigated the relationship between nucleotide conservation level and its structural sensitivity in four model organisms, Escherichia coli, yeast, fly, and mouse.
Results: We define structurally sensitive sites as those with putative local structure-disruptive mutations. Using both the Mantel-Haenszel procedure and association test, we found structurally sensitive nucleotide sites evolved more slowly than non-sensitive sites in all four organisms. Furthermore, we observed that this association is more obvious in highly expressed genes and region near the start codon.
Conclusion: We conclude that structurally sensitive sites in mRNA sequences normally have less nucleotide divergence in all species we analyzed. This study extends our understanding of the impact of RNA structure on coding sequence evolution, and is helpful to the development of a codon model with RNA structure information.
}
}
Matrix 21764 of Study 15642

Citation title:
"The impact of RNA structure on coding sequence evolution in both bacteria and eukaryotes".

Study name:
"The impact of RNA structure on coding sequence evolution in both bacteria and eukaryotes".

This study is part of submission 15642
(Status: Published).
Matrices
Title: mouse data Matrix
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Mus musculus |
(none)
|
ATGAAGGTCTCCACCACTGCCCTTGCTGTT |
Homo sapiens |
(none)
|
ATGCAGGTCTCCACTGCTGCCCTTGCTGTC |
Pan troglodytes |
(none)
|
ATGCAGGTCTCCACTGCTGCCCTTGCTGTC |
Macaca mulatta |
(none)
|
ATGCAGGTCTCCACTGCTGCCCTTGCCGTC |
Rattus norvegicus |
(none)
|
ATGAAGGTCTCCACCGCTGCCCTTGCTGTT |
Bos taurus |
(none)
|
ATGAAGGCGCCCGTGGCTGCTCTCGCCGTT |
Canis lupus familiaris |
(none)
|
ATGAAGGTCCCCGGGGCTGCCCTCGCCGTC |
Equus caballus |
(none)
|
ATGAAGGTCCCCGTGGCTGCCCTTGCCGTC |
Columns
None of the columns has a description.