CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 21914 of Study 15710

About Citation title: "Notes on the powdery mildews (Erysiphales) in Japan II. Erysiphe sect. Microsphaera".
About Study name: "Notes on the powdery mildews (Erysiphales) in Japan II. Erysiphe sect. Microsphaera".
About This study is part of submission 15710 (Status: Published).

Matrices

Title: Microsphera 28S Fig. 1

Description: 28S rRNA gene

Rows

Taxon Label Row Segments Characters 1?–30
Erysiphe glycines ex Desmodium AB022397  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe trifoliorum ex Trifolium AB103078  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe multappendicis ex Berberis AB103076  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe cruciferarum ex Cardaria AB102944  (none) ------------------------------
Erysiphe lycopsidis ex Anchusa AB103072  (none) ------------------------------
Erysiphe heraclei ex Chaerophyllum AB103067  (none) ------------------------------
Erysiphe bremeri ex Alhagi AB103077  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe alphitoides ex Quercus AB257431  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe aquilegiae ex Cimicifuga AB022405  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe corylopsidis ex Corylopsis AB478988  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe friesii ex Rhamnus AB022382  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe heraclei ex Daucus AB022391  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe hypophylla ex Quercus AB292716  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe paeoniae ex Paeonia AB257438  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Pseudoidium sp. ex Medicago AB102942  (none) ------------------------------
Erysiphe quercicola ex Quercus AB292694  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe abbreviata ex Quercus AB271785  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe epigena ex Quercus AB292722  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe hypogena ex Quercus AB292727  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe ligustri ex Ligustrum AB015917  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe monascogera ex Styrax AB331645  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe nomurae ex Symplocos AB331648  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe pulchra var. japonica ex Cornus AB022389  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe pulchra var. pulchra ex Cornus AB015935  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe staphyleae ex Staphylea AB015922  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe syringae ex Syringa AB015920  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe wallrothii ex Vaccinium AB015930  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe vanbruntina ex Sambucus AB015925  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Pseudoidium hortensiae ex Hydrangea MUMH281  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT
Erysiphe wallrothii ex Leucothoe MUMH4752  (none) ------------------------------
Erysiphe platani ex Platanus MUMH5657  (none) TTGACCTCGAATCAGGTAGGAATACCCGCT

Columns

None of the columns has a description.