@ARTICLE{TreeBASE2Ref23575,
author = {Jamjan Meeboon and Siska Arie Siahaan and Susumu Takamatsu},
title = {Notes on powdery mildews (Erysiphales) in Japan: IV. Phyllactinia, Parauncinula and Sawadaea},
year = {2015},
keywords = {28S rRNA gene, Erysiphaceae, ITS, Molecular phylogeny, Morphology},
doi = {10.1016/j.myc.2015.06.001},
url = {http://},
pmid = {},
journal = {Mycoscience},
volume = {56},
number = {6},
pages = {590--596},
abstract = {New records of Phyllactinia, Parauncinula and Sawadaea (Erysiphales) in Japan are reported with morphological and molecular data. These include the first finding of Ph. actinidiae-latifoliae in Japan, the first occurrence of Ph. pyri-serotinae on Aria alnifolia, Pa. septata on Qurcus variabilis and Q. robur, and Sa. polyfida on Acer australe.}
}
Matrix 23778 of Study 16275

Citation title:
"Notes on powdery mildews (Erysiphales) in Japan: IV. Phyllactinia, Parauncinula and Sawadaea".

Study name:
"Notes on powdery mildews (Erysiphales) in Japan: IV. Phyllactinia, Parauncinula and Sawadaea".

This study is part of submission 16275
(Status: Published).
Matrices
Title: Phyllactinia pyri-serotinae ITS
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Phyllactinia moricola ex Morus AB080540 |
(none)
|
CTGAGCGTGAAGACTCTCGGTCCCCCGCCC |
Phyllactinia pyri serotinae ex Aria MUMH3511 |
(none)
|
-----CGTGAAGACTCTCGGGCCCCCCA-- |
Phyllactinia pyri serotinae ex Pyrus AB080521 |
(none)
|
CTGAGCGTGAAGACTCTCGGGCCCCCCC-- |
Phyllactinia mali ex Crataegus AB080523 |
(none)
|
CAGAGCGTGAAGACTCTCGGCCCCCTCCCA |
Phyllactinia mali ex Mespilus AB080556 |
(none)
|
CAGAGCGTGAAGACTTT-GGCCCCCTCCCA |
Phyllactinia mali ex Crataegus AB080559 |
(none)
|
CAGAGCGTGAAGACTCTCGGCCCCCTCCCA |
Columns
None of the columns has a description.