@ARTICLE{TreeBASE2Ref17732,
author = {John V. Syring and R. d. Castillo and Richard C. Cronn and Aaron Liston},
title = {Multiple nuclear loci reveal the distinctiveness of the threatened, neotropical Pinus chiapensis (Pinaceae)},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Pinus chiapensis is a threatened species of pine from southern Mexico and northwestern Guatemala. It was first described as a disjunct variety of the widespread P. strobus from the eastern United States and southeastern Canada. Prior morphological work has suggested that P. chiapensis is a distinct species, but not all authors and pine systematists have accepted that taxonomy. In this study we sequenced multiple accessions from across the range of each of the three most probable progenitors of P. chiapensis at three nuclear loci. Pinus chiapensis had the lowest combined nucleotide diversity of any of the four species (0.0031), and had only a single allele across its entire range at one of the loci. Pinus chiapensis does not share alleles with any of the possible progenitors and the alleles for this pine are monophyletic at two of the three loci. Constraint topologies forcing allelic monophyly at the third locus are not statistically different from the unconstrained trees. While the results are conclusive that P. chiapensis is at least as distinct as the remaining three widely accepted species, determination of the sister species is complicated by lack of species monophyly and interlocus variability. The sympatrically occurring P. ayacahuite, which has been cited as having the potential to hybridize with P. chiapensis, was determined as the least likely progenitor with no evidence for introgression uncovered. The data are conflicting as to whether P. monticola or P. strobus is more closely related to P. chiapensis. Lacking knowledge of the sister species, any phylogeographic story is premature. Rangewide population sampling of P. chiapensis failed to uncover any consistent population structure as has been supported in other studies. The loss of habitat and overexploitation of this resource, in combination with extremely limited genetic diversity, make conservation of P. chiapensis a high priority.}
}
Matrix 2743 of Study 1631

Citation title:
"Multiple nuclear loci reveal the distinctiveness of the threatened, neotropical Pinus chiapensis (Pinaceae)".

This study was previously identified under the legacy study ID S1580
(Status: Published).
Matrices
Title: cesA
Description: Legacy TreeBASE Matrix ID = M2844
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pinus strobus 22S4 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus strobus 11S3 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus strobus 09S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus strobus 04S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus strobus 03S2 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus strobus 01S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus squamata |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 16S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 13S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 07S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 06S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 05S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 02S2 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus monticola 01S1 |
(none)
|
?????????????????????????????? |
Pinus gerardiana |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus chiapensis 41S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus chiapensis 39S1 |
(none)
|
?????????GGCCAGACCTAAGGCGAGCCG |
Pinus chiapensis 38S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus chiapensis 35S1 |
(none)
|
?????????????????????????????? |
Pinus chiapensis 03S4 |
(none)
|
?????????????????????????????? |
Pinus chiapensis 02S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus bungeana |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus ayacahuite 15S2 |
(none)
|
?????????????????????????AGCCG |
Pinus ayacahuite 12S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Pinus ayacahuite 01S1 |
(none)
|
TCCAGCTGCGGCCAGACCTAAGGCGAGCCG |
Columns
None of the columns has a description.