@ARTICLE{TreeBASE2Ref25132,
author = {Banafsheh Safaiefarahani and Reza Mostowfizadeh-Ghalamfarsa and Giles E. St.J. Hardy and Treena I Burgess},
title = {Re-evaluation of the Phytophthora cryptogea species complex and the description of a new species, Phytophthora pseudocryptogea sp. nov.},
year = {2015},
keywords = {Oomycota; Multigene phylogeny; Potato pink rot; Soil pathogen},
doi = {10.1007/s11557-015-1129-9},
url = {http://},
pmid = {},
journal = {Mycological Progress},
volume = {14},
number = {108},
pages = {},
abstract = {Many studies over recent years have recognised Phytophthora cryptogea as a species complex, with several distinct lineages perhaps representing as yet undescribed spe- cies. Additionally, the taxonomic status of the related species P. erythroseptica is also a matter of controversy. In this study, phylogenetic relationships were clarified using nuclear (inter- nal transcribed spacers, ?-tubulin, heat shock protein 90, elicitin) and mitochondrial (cytochrome c oxidase subunit I, NADH dehydrogenase subunit I) gene regions. Our results showed three distinct phylogenetic lineages within P. cryptogea in combined nuclear and mitochondrial gene trees. The molecular divergence observed among these three phylogenetic lineages justifies their re-description as separate species. The first group, including the type isolate, is P. cryptogea sensu stricto, the second group corresponds to the undescribed taxon P. sp. kelmania and the third group is described here as P. pseudocryptogea sp. nov. Although some morphological differences between P. cryptogea and P. pseudocryptogea were notable, they were not sufficient to reliably distinguish these species. Moreover, in all of our phy- logenetic trees (with the exception of elicitin), P. erythroseptica isolates were in a strongly supported mono- phyletic clade. This clade shares a recent common ancestor with P. cryptogea sensu stricto, but is clearly distinct from P. cryptogea. Our results therefore confirmed the position of P. erythroseptica as a distinct species and a close relative to the P. cryptogea species complex.}
}
Matrix 1615 of Study 18303

Citation title:
"Re-evaluation of the Phytophthora cryptogea species complex and the description of a new species, Phytophthora pseudocryptogea sp. nov.".

Study name:
"Re-evaluation of the Phytophthora cryptogea species complex and the description of a new species, Phytophthora pseudocryptogea sp. nov.".

This study is part of submission 18303
(Status: Published).
Matrices
Title: FahrenholziaCOIEF1
Description: Legacy TreeBASE Matrix ID = M2863
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Fahrenholzia zacatecae 28 |
(none)
|
AAGAACGTATCCGTGAAGGAATTACGTCGT |
| Fahrenholzia boleni 5 |
(none)
|
AAGAACGTGTCCGTGAAGGAATTGCGCCGT |
| Fahrenholzia texana 7 |
(none)
|
AAGAATGTGTCTGTGAAGGAATTGCGTCGT |
| Fahrenholzia microcephala 9 |
(none)
|
AAGAATGTGTCCGTGAAGGAATTGCGTCGT |
| Fahrenholzia pinnata 35UNLV3862 |
(none)
|
AAGAACGTGTCCGTGAAGGAATTGCGCCGT |
| Fahrenholzia pinnata 35UNLV3886 |
(none)
|
AAGAACGTGTCCGTGAAGGAATTGCGCCGT |
| Fahrenholzia pinnata 34 |
(none)
|
AAGAACGTGTCCGTGAAGGAATTGCGCCGT |
| Fahrenholzia ehrlichi 12 |
(none)
|
AAGAATGTGTCTGTGAAGGAATTGCGTCGT |
| Fahrenholzia fairchildi 1 |
(none)
|
AAGAACGTGTCTGTGAAGGAATTGCGTCGT |
| Fahrenholzia ferrisi 15 |
(none)
|
AAGAACGTGTCTGTGAAGGAATTGCGTCGT |
| Fahrenholzia hertigi 15 |
(none)
|
AAGAACGTGTCTGTGAAGGAGTTGCGTCGT |
| Fahrenholzia pinnata 36MLZ2046 |
(none)
|
AAGAACGTGTCCGTGAAGGAATTGCGCCGT |
| Fahrenholzia reducta 19MLZ1863 |
(none)
|
AAGAACGTATCTGTGAAGGAATTACGTCGT |
| Fahrenholzia tribulosa 22 |
(none)
|
AAGAACGTATCTGTGAAGGAATTACGTCGT |
| Fahrenholzia pinnata 28 |
(none)
|
AAGAACGTGTCCGTGAAGGAATTGCGCCGT |
| Polyplax auricularis |
(none)
|
AAGAACGTACCTGTTAAAGATTTGCGTCGT |
Columns
None of the columns has a description.