@ARTICLE{TreeBASE2Ref23700,
author = {M?lanie Thomas and Lise Pingault and Axel Poulet and Micka?l throude and Jorge Duarte and S?bastien Faure and jean-Philippe Pichon and Etienne Paux and aline valeska Probst and Christophe Tatout},
title = {Evolutionary history of Methyltransferase 1 genes in hexaploid wheat},
year = {2014},
keywords = {DNA methylation, Evolution, Genome dynamics, CG-rich isochores},
doi = {10.1186/1471-2164-15-922},
url = {http://www.biomedcentral.com/1471-2164/15/922},
pmid = {25342325},
journal = {BMC Genomics},
volume = {15},
number = {October},
pages = {922},
abstract = {Background: Plant and animal methyltransferases are key enzymes with DNA methylation maintenance activity at cytosine residues, required for gene expression control and genome stability. Taking advantage of the new sequence surveys of the wheat genome recently released by the International Wheat Genome Sequencing Consortium, we identified and characterized MET1 genes in hexaploid wheat Triticum aestivum (TaMET1).
Results: Nine TaMET1 genes were identified and mapped on homoeologous chromosome groups 2A/2B/2D, 5A/5B/5D and 7A/7B/7D. Synteny analysis and evolution rates suggest that the genome organization of TaMET1 genes results from a whole genome duplication shared within the grass family, and a second gene duplication, which occurred specifically in the Triticeae tribe prior to the speciation of diploid wheat. Higher expression levels were observed for TaMET1 homoeologous group 2 genes compared to group 5 and 7 indicating that group 2 homoeologous genes are the predominant genes encoding methyltransferase 1 based on transcript level, while group 5 evolved into pseudogenes. We show the connection between low expression levels, elevated evolution rates and unexpected enrichment in CG-dinucleotides (CG-rich isochores) at putative promoter regions of homoeologous groups 5 and 7 but not of group 2 TaMET1 genes. Bisulfite sequencing reveals that these CG-rich isochores are highly methylated in a CG context, which is the expected target of TaMET1.
Conclusions: We retraced the evolutionary history of MET1 genes in wheat highlighting the predominance of group 2 homoeologous genes and suggest CG-DNA methylation as one of the mechanisms involved in wheat genome dynamics.
}
}
Matrix 24238 of Study 16421

Citation title:
"Evolutionary history of Methyltransferase 1 genes in hexaploid wheat".

Study name:
"Evolutionary history of Methyltransferase 1 genes in hexaploid wheat".

This study is part of submission 16421
(Status: Published).
Matrices
Title: MET1 cDNA alignment with MUSCLE
Description: Used as a matrix in Figure 2
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Medicago truncatula MtMET1 |
(none)
|
---AAACAGTGCAGCGGAAAGGACAGCACG |
| Pisum sativum PsMET1 |
(none)
|
GGTGGCAAGGACAGCACG------------ |
| Daucus carota DcMET1 |
(none)
|
ATAAGAGGACCCAGATCGAGGTCTTGAAAC |
| Solanum lycopersicum SlMET1 |
(none)
|
----------GCAAAGCAACAACGACAAAT |
| Nicotiana tabacum NtMET1 |
(none)
|
ACAAAAAGGAGAAAAGCAGTGTCAAAAAGG |
| Sorghum bicolor SbMET1b |
(none)
|
ACAAGAAGATGCAGAGCAAAGCCACAAAAG |
| Zea mays ZmMET1b-1 |
(none)
|
ACAAGAAGATGCAGAGCAAAGCCACAAAAG |
| Zea mays ZmMET1b-2 |
(none)
|
ACAAGAAGATGCAGAGCAAAGCCACAAAAG |
| Oryza sativa OsMET1b |
(none)
|
AAGAAAAGGTGCAGAGCAAAGCCACAAAAG |
| Brachypodium distachyon BdMET1b |
(none)
|
------------------------------ |
| Hordeum vulgare HvMET1-2 |
(none)
|
ACAAAAAGGTGCAGAGCAAAGCCACAAAAG |
| Triticum aestivum TaMET-2B1 |
(none)
|
ACAAAAAGGTGCAGAGCAAAGCCACAAAAG |
| Triticum aestivum TaMET-2A1 |
(none)
|
ACAAAAAGGTGCAGAGCAAAGCCACAAAAG |
| Triticum aestivum TaMET-2D1 |
(none)
|
ACAAAAAGGTGCAGAGCAAAGCCACAAAAG |
| Sorghum bicolor SbMET1a |
(none)
|
ACAAAGAAGCACAAAGCAAAGCTGCAGAAT |
| Oryza sativa OsMET1a |
(none)
|
ACAAAAAGGCGTAGAGCAAAGGTTCATAA- |
| Brachypodium distachyon BdMET1a |
(none)
|
------------------------------ |
| Hordeum vulgare HvMET1-7 |
(none)
|
AAAAAGAGGCGCAGACCTAAGCTTCATAAG |
| Triticum aestivum TaMET-7B1 |
(none)
|
ACAAAGAGGCGCAGACCTAAGCTTCATAAG |
| Triticum aestivum TaMET-7A1 |
(none)
|
--------------ACCTAAGCTTCATAAG |
| Triticum aestivum TaMET-7D1 |
(none)
|
AGAAAGAGGCGCAGACCTAAGCTTCATAAG |
| Hordeum vulgare HvMET1-5 |
(none)
|
------------------------------ |
| Triticum aestivum TaMET-5A1 |
(none)
|
ACAAAGAGGCACCAAGCAAAGCCTAAAAGC |
| Triticum aestivum TaMET-5B1 |
(none)
|
ACAAAGAGGCGCCAAGCAAAGCCTAAAAGC |
| Triticum aestivum TaMET-5D1 |
(none)
|
------------------------------ |
| Brassica rapa BrMET1b |
(none)
|
TAAAAATGAAATAAAGGAAGGTTTTAGAAA |
| Arabidopsis thaliana AtMET1 |
(none)
|
------------------------------ |
| Brassica rapa BrMET1a |
(none)
|
ATAAATTTGAATAGCGTAAGGTTTACGGAG |
Columns
None of the columns has a description.