@ARTICLE{TreeBASE2Ref17160,
author = {Denise Raterman and Robert W. Meredith and Luis A. Ruedas and Mark S. Springer},
title = {Phylogenetic relationships of the cuscuses and brushtail possums using the nuclear gene, BRCA1 (Marsupialia: Phalangeridae)},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Australian Journal of Zoology},
volume = {},
number = {},
pages = {},
abstract = {The family Phalangeridae is comprised of approximately two-dozen extinct and extant species that include the brushtail possums (Trichosurus), scaly-tailed possum (Wyulda) and cuscuses (Phalanger, Strigocuscus, Spilocuscus, and Ailurops). Morphological studies have suggested that Ailurops ursinus is the sister taxon to all other phalangerids. Another relationship of interest is Strigocuscus celebensis, whose morphologically based taxonomic affinity has habitually been with trichosurins. Mitochondrial 12S rRNA results, however, found moderate support for an Ailurops and Strigocuscus celebensis clade and placed A. ursinus and S. celebensis as sister to Phalanger and Spilocuscus. This study uses nuclear sequence data from the breast cancer and ovarian cancer susceptibility gene 1 (BRCA1) to test previous mitochondrial DNA results and uses relaxed molecular clock methods to estimate divergence dates. The results support Ailurops as sister taxa to S. celebensis and this clade as sister to Phalangerini. Relaxed molecular dating methods suggest a date of 21-29 million years for the split between Trichosurini and remaining phalangerids and 17-24 million years for the split between Ailurops + Strigocuscus celebensis and Phalangerini. Several vicariant/dispersal events are necessary to explain the geographic distribution of Phalangeridae and our estimated molecular divergence dates are congruent with previously proposed Southeast Asian geological events.}
}
Matrix 862 of Study 1678

Citation title:
"Phylogenetic relationships of the cuscuses and brushtail possums using the nuclear gene, BRCA1 (Marsupialia: Phalangeridae)".

This study was previously identified under the legacy study ID S1638
(Status: Published).
Matrices
Title: BRCA1
Description: Legacy TreeBASE Matrix ID = M2959
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Vombatus ursinus |
(none)
|
??TCATTACTTCCTAAAACCAGCAGTTTAT |
| Phascolarctos cinereus |
(none)
|
??TCATTACTTCCTGAAACCACCAGTTTAT |
| Phalanger gymnotis |
(none)
|
?????????????????????????????? |
| Bettongia penicillata |
(none)
|
?????????????????????????????? |
| Phalanger lullulae |
(none)
|
?????????????????????????????? |
| Trichosurus caninus |
(none)
|
????????????????????????GTTTAT |
| Gymnobelideus leadbeateri |
(none)
|
GGTCATTACTTCCTGAAACGACCAGTTTGT |
| Pseudocheirus herbertensis |
(none)
|
??TCATTACTTCCTGAAACAACCAGTTTAT |
| Trichosurus vulpecula |
(none)
|
?????????????????????????????? |
| Strigocuscus celebensis |
(none)
|
????????????????????ACCAGTTTAT |
| Ailurops ursinus |
(none)
|
??????????????GAAACCACCAGTTTAT |
| Phalanger orientalis |
(none)
|
GCTCATTACTTTCTGAAACCACCAGTTTAT |
| Spilocuscus rufoniger |
(none)
|
?????????????????????CCAGTTTAT |
| Macropus rufus |
(none)
|
??TCATTACTTCCTGAAACCACCAGCTTAT |
| Spilocuscus maculatus |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.