@ARTICLE{TreeBASE2Ref24004,
author = {Huzefa A Raja and Tamam El-Elimat and Carol A. Shearer and Andrew N. Miller and Kazuaki Tanaka and Akira Hashimoto and Jacques Fournier and Nicholas Oberlies},
title = {Minutisphaerales (Dothideomycetes, Ascomycota): a new order of freshwater ascomycetes including a new family, Minutisphaeraceae, and two new species from North Carolina, USA},
year = {2015},
keywords = {Aquatic, microfungi, submerged wood, systematics},
doi = {10.3852/15-013},
url = {http://},
pmid = {},
journal = {Mycologia},
volume = {107},
number = {4},
pages = {845?862},
abstract = {Minutisphaera is a recently established
genus of freshwater Dothideomycetes characterized
by small, globose to subglobose or apothecioid,
erumpent to superficial, brown ascomata; fissitunicate,
eight-spored, ovoid to obclavate asci; and 1?2-
septate, clavate to broadly fusiform, hyaline to pale
brown ascospores with or without a gelatinous sheath
and filamentous appendages. The genus currently
contains two species: M. fimbriatispora, the type
species, and M. japonica. The higher-level phylogenetic
relationship of Minutisphaera within the Dothideomycetes
currently is unresolved. To establish the
phylogenetic position of Minutisphaera within the
Dothideomycetes and evaluate the phylogenetic
affinities of newly collected Minutisphaera-like taxa,
we sequenced three rDNA regions?18S, ITS1-5.8SITS2
(ITS) and 28S nuc rDNA, and a protein-coding
gene, MCM7, for newly collected strains of Minutisphaera.
Based on maximum likelihood and Bayesian
analyses of a combined dataset (18S and 28S)
composed of 167 taxa, a more refined dataset (28S
and MCM7) comprising 52 taxa and a separate ITS
dataset, and an examination of morphology, we
describe and illustrate two new species of Minutisphaera.
The Minutisphaera clade was strongly supported
within the Dothideomycetes with likelihood
and Bayesian statistics but did not share phylogenetic
affinities with any existing taxonomic group within
the Dothideomycetes. We therefore establish a new
order, Minutisphaerales, and new family, Minutisphaeraceae,
for this monophyletic clade of freshwater
ascomycetes. Chemical analysis of the organic
extract M. aspera (G427) resulted in isolation and
characterization of five known secondary metabolites,
of which four were dipeptides (1?4) and one an
aromatic polyketide (5). Conversely, two aromatic
polyketides (5, 6) were isolated and identified from
the organic extract of M. parafimbriatispora (G156-4).
The isolated compounds were tested for their
antimicrobial activity against an array of bacteria
and fungi. Compound 6 showed promising activity
against Staphylococcus aureus and Mycobacterium
smegmatis with minimal inhibitory concentration
values of 30 and 60 mg/mL, respectively.}
}
Matrix 25356 of Study 16824

Citation title:
"Minutisphaerales (Dothideomycetes, Ascomycota): a new order of freshwater ascomycetes including a new family, Minutisphaeraceae, and two new species from North Carolina, USA".

Study name:
"Minutisphaerales (Dothideomycetes, Ascomycota): a new order of freshwater ascomycetes including a new family, Minutisphaeraceae, and two new species from North Carolina, USA".

This study is part of submission 16824
(Status: Published).
Matrices
Title: Minutisphaeraceae ITS data
Description: ITS data
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Minutisphaera japonica AB733435 |
(none)
|
GAAGGATCATTAAAAG---TTTGTTCGAGG |
Minutisphaera japonica NR 119419.1 |
(none)
|
GAAGGATCATTAAAAG---TTTGTTCGAGG |
Minutisphaera japonica AB733436 |
(none)
|
GAAGGATCATTAAAAG---TTTGTTCGAGG |
Didymosphaeria sp. TS 04 050 HQ713763 |
(none)
|
-------CATTAAAAG----TTGTTCGAGG |
Pleosporales sp. 39g X244063 |
(none)
|
------------------AGTTGTTCGAGG |
Minutisphaera_parafibmriatispora_G156-1a_JX474875_type |
(none)
|
GAAGGATCATTAAAAAAAAGTTGTGCGAGG |
Minutisphaera fimbriatispora JX474872 |
(none)
|
GAAGGATCATTAAAAAAAAGTTGTGTGAGG |
Minutisphaera fimbriatispora JX474871 |
(none)
|
-AAGGATCATTAAAAAAAAGTTGTGTGAGG |
Minutisphaera_sp._G156-2_JX474877 |
(none)
|
GAAGGATCATTAAAAAAACGTTGTGTGAGG |
Minutisphaera_sp._G156-2_JX474876 |
(none)
|
GAAGGATCATTAAAAAAACGTTGTGTGAGG |
Minutisphaera fimbriatispora G155 1 JX474874 |
(none)
|
G{AG}AGGATCATTAAAAAAAAGTTGTGTG |
Minutisphaera fimbriatispora G155 1 JX474873 |
(none)
|
GAAGGATCATTAAAAAAAAGTTGTGTGAGG |
Minutisphaera aspera G427 1a Type |
(none)
|
GAAGGATCATTAAAAG----TTGCTCGAGG |
Minutisphaera aspera G427 1b ITS |
(none)
|
-------CATTAAAAG----TTGCTCGAGG |
Minutisphaera parafimbriatispora G156 4a |
(none)
|
-------CATTAAAAAAAAGTTGTGCGAGG |
Minutisphaera parafimbriatispora G156 4b |
(none)
|
-------CATTAAAAAAAAGTTGTGCGAGG |
Columns
None of the columns has a description.