@ARTICLE{TreeBASE2Ref15080,
author = {T. L. P. Couvreur and W. J. Hahn and J. J. de Granville and J. L. Pham and B. Lude?a and J. C. Pintaud},
title = {Phylogenetic relationships of the cultivated Neotropical palm Bactris gasipaes (Arecaceae) with its wild relatives inferred from chloroplastic and nuclear DNA polymorphisms},
year = {2007},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach palm with wild Bactris taxa are still in doubt, and have never been addressed using molecular sequence data. We generated a chloroplast DNA phylogeny using intergenic spacers from a sampling of cultivars of Bactris gasipaes as well as putative wild relatives and other members of the genus Bactris. We estimated phylogenetic relationships using Maximum Parsimony (MP), Maximum Likelihood (ML) and Bayesian analysis. Our results indicated a close affinity between three taxa: Bactris gasipaes var. gasipaes, B. gasipaes var. chichagui, and B. riparia. There was no clear differentiation between these three taxa at the level of chloroplast sequences, and they shared a unique inversion that we characterized in this paper. Bactris setulosa, a species potentially related to the Bactris gasipaes complex, appeared highly divergent, and seemed to be a composite taxon with affinities outside the complex. We also investigated nuclear microsatellite polymorphisms at 8 loci within Bactris gasipaes, B. riparia, and B. setulosa, finding a pattern of relationships in agreement with the cpDNA data. The results presented here are important for future studies on domestication and crop improvement of Bactris gasipaes.}
}
Matrix 1705 of Study 1723

Citation title:
"Phylogenetic relationships of the cultivated Neotropical palm Bactris gasipaes (Arecaceae) with its wild relatives inferred from chloroplastic and nuclear DNA polymorphisms".

This study was previously identified under the legacy study ID S1686
(Status: Published).
Matrices
Title: Three Markers
Description: Legacy TreeBASE Matrix ID = M3046
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Bactris setulosa 813 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris setulosa 775 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris setulosa 703 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris riparia 924 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris riparia 911 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris riparia 611 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris gasipaes var gasipaes 301 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris gasipaes var gasipaes 266 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris gasipaes var gasipaes 265 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris gasipaes var chichagui 268 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Bactris gasipaes var chichagui 267 |
(none)
|
CCACATGAAACATAAAATTGTTAACGAGAA |
Columns
None of the columns has a description.