@ARTICLE{TreeBASE2Ref17352,
author = {M. V. Sanchez-Puerta and Tsvetan R. Bachvaroff and Charles F. Delwiche},
title = {Sorting wheat from chaff in multi-gene analyses of chlorophyll-c containing plastids},
year = {2007},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Photosynthetic eukaryotes contain primary, secondary or tertiary plastids, depending on the source of the organelle (a cyanobacterium or a photosynthetic eukaryote). Plastid phylogeny is relatively well investigated, but molecular phylogenies have conflicted as a function of gene choice, taxon-representations, and analytical method. To better understand the influences of these variables, we performed analyses of a multi-gene data set based on 62 plastid-associated genes of 15 taxa representing the major plastid lineages. In an attempt to distinguish phylogenetic signal from non-phylogenetic patterns, we analyzed the data using a wide range of phylogenetic methods and examined the effect of covarion evolution and compositional bias. The data suggest that the chlorophyll c-containing plastids are monophyletic and acquired their plastids from the red algae after the emergence of the Cyanidiales. The relationships among chl c-containing plastids are particularly hard to resolve. This is the largest data set used for this purpose; the analyses show that cryptophyte plastids are sister to other chl c-containing plastids, and haptophyte and peridinin-containing dinoflagellate plastids are closely related.}
}
Matrix 1780 of Study 1755

Citation title:
"Sorting wheat from chaff in multi-gene analyses of chlorophyll-c containing plastids".

This study was previously identified under the legacy study ID S1722
(Status: Published).
Matrices
Title: 62-genes 4
Description: Legacy TreeBASE Matrix ID = M3123
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Cyanophora sp. |
(none)
|
TCAGCACAAGTTTTACGAAAATTAGCGGAA |
Nephroselmis sp. |
(none)
|
------------------------------ |
Chaetosphaeridium sp. |
(none)
|
------------------------------ |
Mesostigma sp. |
(none)
|
------------------------------ |
Arabidopsis sp. |
(none)
|
TCAGCTCAGGTTCTAAGGAAACTTGTGGAT |
Emiliania sp. |
(none)
|
TCGGCGCAAGTTTTAAGGAAATTAGCAGAT |
Odontella sp. |
(none)
|
TCTGCTCAAGTACTAAGAAAATTAATTAAT |
Guillardia sp. |
(none)
|
TCTGCTGAAGTATTACGAAAATTAGTAGAT |
Cyanidium sp. |
(none)
|
TCGGCCCAAGTTATAAGAAAACTAACTGAA |
Cyanidioschyzon sp. |
(none)
|
TCAGCACAAGTTTTAAGAAAATTAGTGGAT |
Gracilaria sp. |
(none)
|
TCTGCTCAGGTATTACGTAAGTTAGTTGAG |
Porphyra sp. |
(none)
|
TCTGCTCAAGTATTAAGAAAACTTGTAGAA |
Synechocystis sp. |
(none)
|
TCTGCCCAAGTGCTGCGGAAATTGGTGGAC |
Nostoc sp. |
(none)
|
TCTGCCAAGGTTCTCCGCAAACTAGTGGAA |
Columns
None of the columns has a description.