@ARTICLE{TreeBASE2Ref18849,
author = {Christer Erseus and Emilia Rota and Lisa Matamoros and Pierre De Wit},
title = {Molecular phylogeny of Enchytraeidae (Annelida, Clitellata)},
year = {2010},
keywords = {Oligochaetes, Molecular systematics, Bayesian inference },
doi = {10.1016/j.ympev.2010.07.005},
url = {http://},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {57},
number = {},
pages = {849--858},
abstract = {A multigene data set (12S, 16S, and COI mitochondrial DNA; 18S and 28S nuclear DNA) was analyzed by Bayesian inference to estimate the phylogeny of a sample of the clitellate family Enchytraeidae (86 species representing 14 nominal genera). The nuclear genes support a sister group relationship between Enchytraeidae and earthworms (Crassiclitellata), but this support is lost when analysing all genes combined. Monophyly, as well as a basal dichotomy, of the family Enchytraeidae obtained maximum support, with one clade containing Hemienchytraeus and Achaeta, the other the remaining 12 genera analysed. The latter group is basally resolved in several well supported clades. Lumbricillus and Grania are closely related. Bryodrilus, Oconnorella, Henlea and two species of Marionina (M. cf. riparia, and M. communis) form a well supported clade. Cognettia is sister to Stercutus, and Cernosvitoviella sister to Mesenchytraeus, and the four together appear to be a monophyletic group. A large part of the taxonomically problematic Marionina appears to be a group not closely related to the type species (M. georgiana), and this group also includes Enchytronia. Further, this Marionina/Enchytronia appears to be sister to a clade comprising the more or less littoral marine genera Stephensoniella and Enchytraeus. Hemifridericia, Buchholzia and Fridericia, the three genera characterized by two types of coelomocytes, also form a well-supported clade. The study corroborates most of the multi-species genera analysed (Cognettia, Cernosvitoviella, Mesenchytraeus, Oconnorella, Henlea, Enchytraeus, Grania, Buchholzia and Fridericia); only Lumbricillus and Marionina are non-monophyletic as currently defined.}
}
Matrix 1785 of Study 10374

Citation title:
"Molecular phylogeny of Enchytraeidae (Annelida, Clitellata)".

Study name:
"Molecular phylogeny of Enchytraeidae (Annelida, Clitellata)".

This study is part of submission 10364
(Status: Published).
Matrices
Title: 24-gene data set
Description: Legacy TreeBASE Matrix ID = M3128
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Cyanophora sp. |
(none)
|
GCCTTCCCT---ATTTATGCTCAACAAGCA |
Nephroselmis sp. |
(none)
|
GCTTATCCA---ATTTATGCGCAGGAAAAC |
Chaetosphaeridium sp. |
(none)
|
GCATTTCCA---ATATATGCACAACAAAAT |
Mesostigma sp. |
(none)
|
GCTTATCCA---ATTTTTGCACAGCAAAAT |
Arabidopsis sp. |
(none)
|
GCATATCCG---ATTTTTGCCCAGCAGAAT |
Emiliania sp. |
(none)
|
GCTTATCCC---GTGTTTGCGCAGCAAGCT |
Odontella sp. |
(none)
|
GCATATCCA---GTCTTTGCTCAACAAGGT |
Guillardia sp. |
(none)
|
GCTTTTCCT---GTATTTGCTCAACAAGCA |
Cyanidium sp. |
(none)
|
TCGTATCCC---ATTTATGCACAGCAAACA |
Cyanidioschyzon sp. |
(none)
|
GCCTATCCC---ATTTATGCGCAACAAGCT |
Gracilaria sp. |
(none)
|
GCATTTCCT---ATATATGCACAACAAGGA |
Porphyra sp. |
(none)
|
GCATTTCCT---ATCTATGCTCAGCAAGCT |
Synechocystis sp. |
(none)
|
GCCTATCCCTTTTGGGCCCAGGAAACAGCG |
Nostoc sp. |
(none)
|
GCATATCCTTTCTGGGCGCAGCAAACTTAC |
Columns
None of the columns has a description.