@ARTICLE{TreeBASE2Ref17960,
author = {Romina Vidal-Russell and Daniel L. Nickrent},
title = {A Molecular Phylogeny of the Feathery Mistletoe Misodendrum},
year = {2007},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Misodendrum comprises eight species of aerial hemiparasites endemic to temperate forests of Chile and Argentina that parasitize Nothofagus. This mistletoe is unique in that it has feathery staminodes on its wind dispersed achenes. Previous classifications included two subgenera, Misodendrum (two sections) and Angelopogon (three sections). The present study tested this classification using two chloroplast genes (trnL-F and matK) and 31 morphological characters. Maximum parsimony, likelihood and Bayesian analyses were performed for individual and combined partitions. Results from analyses of the separate partitions differed only in the positions of M. linearifolium and M. quadriflorum; however, the 2-gene tree gave higher support for M. quadriflorum as sister to all other species. Misodendrum brachystachyum and M. oblongifolium form a well supported clade that is sister to one composed of M. punctulatum, M. gayanum and M. angulatum. These phylogenetic relationships generally agree with previous taxonomic classifications. Subgenus Misodendrum, characterized by warty stems and two stamens, here resolves as a polytomy: M. punctulatum, M. gayanum, and M. angulatum. Subgenus Angelopogon, characterized by the plesiomorphies three stamens and foliacious bracts, is paraphyletic given our rooting. Misodendrum brachystachyum and M. oblongifolium (section Archiphyllum) differ morphologically only by the length of their fruiting staminodes.}
}
Matrix 1796 of Study 1761

Citation title:
"A Molecular Phylogeny of the Feathery Mistletoe Misodendrum".

This study was previously identified under the legacy study ID S1728
(Status: Published).
Matrices
Title: matK trnL-F
Description: Legacy TreeBASE Matrix ID = M3144
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Schoepfia schreberi |
(none)
|
------------------------------ |
| Schoepfia fragrans |
(none)
|
AGATCAAGTTTATTAGAAAATGGAAATTAT |
| Nuytsia floribunda |
(none)
|
-------GTTTGTTAGAAAATGTAGGTTAT |
| Misodendrum quadriflorum |
(none)
|
AGGTCCAGTTTATTAAAAAATGTGGGTTAT |
| Misodendrum punctulatum |
(none)
|
AAATCCAGTTTATTACAAAATGTAAGTTAT |
| Misodendrum oblongifolium |
(none)
|
----------TATTCAAAAATGTAGGTTAT |
| Misodendrum macrolepis |
(none)
|
?????????????????????????????? |
| Misodendrum linearifolium |
(none)
|
------AGTTTATTAAAAAATATAGGTTAT |
| Misodendrum gayanum |
(none)
|
-----------ATTAAAAAATGTAAGTTAT |
| Misodendrum brachystachyum |
(none)
|
--------------------TGTAGGTTAT |
| Misodendrum angulatum |
(none)
|
------------------------------ |
| Gaiadendron punctatum |
(none)
|
---------------------------TAT |
| Atkinsonia ligustrina |
(none)
|
---------------GAAAATGTAGGTTAT |
Columns
None of the columns has a description.