@ARTICLE{TreeBASE2Ref24966,
author = {Yu Ito and Norio Tanaka and Changkyun Kim and Robert Kaul and Dirk Carl Albach},
title = {Phylogeny of Sparganium (Typhaceae) revisited: Non-monophyletic nature of S. emersum sensu lato and resurrection of S. acaule},
year = {2015},
keywords = {Aquatic plants - Plastid DNA - Hybridization - Molecular phylogeny - phyC - Sparganium - Typhaceae},
doi = {10.1007/s00606-015-1245-7},
url = {http://},
pmid = {},
journal = {Plant Systematics and Evolution},
volume = {301},
number = {8},
pages = {},
abstract = {The diploid aquatic genus Sparganium (Typhaceae) comprises ca. 14 species mainly in cool temperate regions of the world. Among these, S. emersum comprises two infraspecific taxa, subspecies acaule from eastern North America and subspecies emersum from Eurasia and western North America (and occasionally from eastern North America as well). However, there has been some discussion regarding the monophyly of S. emersum sensu lato. We tested the hypothesis of a polyphyletic S. emersum sensu lato in a phylogenetic framework. Sequence data from six plastid DNA regions and nuclear phyC were analyzed using maximum parsimony, maximum likelihood, and Bayesian inference. We obtained a moderately resolved phylogeny with the plastid DNA data set, while phylogenetically less-informative phyC was useful to distinguish morphological species and discern hybrid and non-hybrid specimens. Sparganium emersum sensu lato was resolved as polyphyletic, clustering with S. angustifolium and S. glomeratum, respectively. Sparganium acaule is resurrected to be a sister to S. glomeratum, for which synapomorphic and distinguishing morphological characters are provided. Three cases of hybridization were detected.}
}
Matrix 32013 of Study 17840

Citation title:
"Phylogeny of Sparganium (Typhaceae) revisited: Non-monophyletic nature of S. emersum sensu lato and resurrection of S. acaule".

Study name:
"Phylogeny of Sparganium (Typhaceae) revisited: Non-monophyletic nature of S. emersum sensu lato and resurrection of S. acaule".

This study is part of submission 17840
(Status: Published).
Matrices
Title: Sparganium PhyC MP
Description: Sparganium_PhyC_MP
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Sparganium erectum |
(none)
|
?????????????????????????????? |
Sparganium natans |
(none)
|
?????????????????????????????? |
Sparganium hyperboreum |
(none)
|
?????????????????????????????? |
Sparganium acaule |
(none)
|
?????????????????????????????? |
Sparganium androcladum |
(none)
|
?????????????????????????????? |
Sparganium angustifolium KF265470 |
(none)
|
?????????????????????????????? |
Sparganium angustifolium KF265472 |
(none)
|
AAATCAGATTTGGAGCCTTATCTTGGCTTA |
Sparganium americanum |
(none)
|
???????????????????ATCTTGGCTTA |
Sparganium emersum Albach.sp04 |
(none)
|
?????????????????????????????? |
Sparganium emersum Papchenkov |
(none)
|
?????????????????????????????? |
Sparganium fallax |
(none)
|
?????????????????????????????? |
Sparganium fluctuans |
(none)
|
?????????????????????????????? |
Sparganium glomeratum KF265482 |
(none)
|
AACTCAGATTTGGAGCCTTATCTTGGCTTA |
Sparganium glomeratum KF265483 |
(none)
|
AACTCAGATTTGGAGCCTTATCTTGGCTTA |
Sparganium glomeratum KF265489 |
(none)
|
?????????????????????????????? |
Sparganium gramineum |
(none)
|
AAATCAGATTTGGAGCCTTATCTTGGCTTA |
Sparganium japonicum TD3589 |
(none)
|
?????????????????????????????? |
Sparganium japonicum YI1055 |
(none)
|
?????????????????????????????? |
Sparganium subglobosum |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.