Matrix 32016 of Study 17842
Matrices
Title: Hebeloma sect. Denudata RPB2
Description: Hebeloma sect. Denudata RPB2
Rows
Taxon Label | Row Segments | Characters 1?–30 |
---|---|---|
Hebeloma aanenii HJB10164 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma aanenii HJB10282 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma aanenii HJB10607 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma aanenii UPS AT2003063 HJB10670 | (none) | CTTGCTTTGATGGC{CT}TGCATATCGGTC |
Hebeloma aanenii holotype BR BRMYCO 173987 66 HJB12630 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma alpinum HJB11051 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma alpinum HJB10642 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma alpinum HJB11085 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma alpinum HJB11094 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma alpinum HJB11117 | (none) | CTTGCT{CT}TGATGGCCTGCATATCGGTC |
Hebeloma alpinum HJB11132 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma alpinum HJB12005 | (none) | ------------------------------ |
Hebeloma alpinum HJB13096 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma ammophilum holotype BP 56934 HJB1000051 | (none) | ------------------------------ |
Hebeloma ammophilum HJB10803 | (none) | ------------------------------ |
Hebeloma ammophilum HJB11527 | (none) | ------------------------------ |
Hebeloma ammophilum GB EL281 08 HJB12374 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma aurantioumbrinum C JV00 291 HJB10906 | (none) | ------------------------------ |
Hebeloma aurantioumbrinum HJB11934 | (none) | ------------------------------ |
Hebeloma aurantioumbrinum HJB12012 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma aurantioumbrinum holotype BR BRMYCO173985 64 HJB12058 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma aurantioumbrinum HJB12445 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma litoreum holotype K K M 0802 HJB1000004 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes holotype L L960 110 524 HJB1000010 | (none) | ------------------------------ |
Hebeloma alvarense holotype TUR 17955F HJB1000120 | (none) | ------------------------------ |
Hebeloma vejlense holotype C JV00 251 HJB1000132 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma litoreum holotype ROHB 01313 HJB1000225 | (none) | ------------------------------ |
Hebeloma cavipes HJB10331 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10336 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10337 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes C JV04 579 HJB10343 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10451 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10453 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10524 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10537 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10544 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB10548 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes PDD 102993 HJB10691 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes C JV04 637 HJB10709 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes C JV99 511 HJB10718 | (none) | ------------------------------ |
Hebeloma cavipes C JV03 507 HJB10720 | (none) | ------------------------------ |
Hebeloma cavipes HJB10796 | (none) | ------------------------------ |
Hebeloma cavipes HJB10804 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes C JV00 690 HJB10900 | (none) | ------------------------------ |
Hebeloma cavipes C JV92 298 HJB10951 | (none) | ------------------------------ |
Hebeloma cavipes BR VJ00071 HJB10973 | (none) | ------------------------------ |
Hebeloma cavipes GLM GL42741 HJB10997 | (none) | ------------------------------ |
Hebeloma cavipes HJB11305 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB11379 | (none) | ------------------------------ |
Hebeloma cavipes HJB11403 | (none) | ------------------------------ |
Hebeloma cavipes C JV05 720 HJB11405 | (none) | ------------------------------ |
Hebeloma cavipes C JV05 792 HJB11428 | (none) | ------------------------------ |
Hebeloma cavipes C JV05 791 HJB11429 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB11621 | (none) | ------------------------------ |
Hebeloma cavipes HJB11746 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB11747 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB11750 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB11758 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB11791 | (none) | ------------------------------ |
Hebeloma cavipes C JV06 593 HJB11843 | (none) | ------------------------------ |
Hebeloma cavipes TURA 25408 HJB12305 | (none) | ------------------------------ |
Hebeloma cavipes C JV08 118 HJB12320 | (none) | ------------------------------ |
Hebeloma cavipes C JV08 353 HJB12345 | (none) | ------------------------------ |
Hebeloma cavipes C JV08 350 HJB12346 | (none) | ------------------------------ |
Hebeloma cavipes C JV08 254 HJB12349 | (none) | ------------------------------ |
Hebeloma cavipes C JV87 407 HJB12352 | (none) | ------------------------------ |
Hebeloma cavipes C JV89 1334 HJB12354 | (none) | ------------------------------ |
Hebeloma cavipes C JV93 317 HJB12357 | (none) | ------------------------------ |
Hebeloma cavipes C JV85 615 HJB12358 | (none) | ------------------------------ |
Hebeloma cavipes C JV84 1298 HJB12360 | (none) | ------------------------------ |
Hebeloma cavipes C JV94 1013 HJB12363 | (none) | ------------------------------ |
Hebeloma cavipes C JV93 1067 HJB12365 | (none) | ------------------------------ |
Hebeloma cavipes C JV86 489 HJB12414 | (none) | ------------------------------ |
Hebeloma cavipes L WBS9427 HJB12482 | (none) | ------------------------------ |
Hebeloma cavipes HJB12603 | (none) | ------------------------------ |
Hebeloma cavipes HJB12664 | (none) | ------------------------------ |
Hebeloma cavipes HJB12673 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB12688 | (none) | ------------------------------ |
Hebeloma cavipes C JV08 513 HJB12800 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes C Larsen227 2007 HJB13006 | (none) | ------------------------------ |
Hebeloma cavipes C H5 06 HJB13074 | (none) | ------------------------------ |
Hebeloma cavipes HJB13217 | (none) | ------------------------------ |
Hebeloma cavipes HJB13282 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes C JV09 743LSa2009 79355 HJB13437 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes S F28516 HJB13468 | (none) | ------------------------------ |
Hebeloma cavipes HJB13498 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB13722 | (none) | ------------------------------ |
Hebeloma cavipes HJB13723 | (none) | ------------------------------ |
Hebeloma cavipes HJB13725 | (none) | ------------------------------ |
Hebeloma cavipes HJB13726 | (none) | ------------------------------ |
Hebeloma cavipes HJB13729 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB13733 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB13873 | (none) | ------------------------------ |
Hebeloma cavipes HJB8105 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB9380 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB9433 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma cavipes HJB9878 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma crustuliniforme HJB11237 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma crustuliniforme L WBS9689 HJB12481 | (none) | ------------------------------ |
Hebeloma crustuliniforme L WBS9581 HJB12807 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma crustuliniforme L WBS9546 HJB12811 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma crustuliniforme epitype BR BR MYCO173989 68 HJB13713 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma crustuliniforme HJB9053 | (none) | ------------------------------ |
Hebeloma eburneum HJB10290 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma eburneum HJB10525 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma eburneum L WBS9511 HJB12501 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma eburneum HJB12670 | (none) | CTTGCT{GT}TGATGGC{CG}TGCATATCG |
Hebeloma eburneum C JV08 451 HJB12769 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma eburneum L WBS9686 HJB12996 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma eburneum HJB9267 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma echinosporum holotype BR BR MYCO174907 16 HJB13524 | (none) | CTTGCCTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes holotype PC PC0090764 R63 179 HJB1000031 | (none) | ------------------------------ |
Hebeloma fragilipes HJB10567 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes HJB10568 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes HJB11435 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes HJB11720 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes HJB11737 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes TURA 11957 HJB12392 | (none) | ------------------------------ |
Hebeloma fragilipes HJB12608 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes L WBS9694 HJB12802 | (none) | ------------------------------ |
Hebeloma fragilipes HJB13277 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma fragilipes HJB13344 | (none) | ------------------------------ |
Hebeloma fragilipes HJB13614 | (none) | ------------------------------ |
Hebeloma geminatum HJB10384 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma geminatum holotype C C F 90152 HJB10833 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma geminatum TURA 17928F HJB10961 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma geminatum HJB12655 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma geminatum HJB8633 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma helodes HJB10606 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma helodes HJB10680 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma helodes HJB11698 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma helodes HJB12634 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma helodes HJB8115 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma helodes HJB8816 | (none) | ------------------------------ |
Hebeloma oculatum holotype LY BR64 29 HJB1000039 | (none) | ------------------------------ |
Hebeloma hiemale HJB10130 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10163 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10296 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10370 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10440 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10464 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10469 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10472 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10484 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10539 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10702 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale C JHC00 067 HJB10724 | (none) | ------------------------------ |
Hebeloma hiemale HJB10756 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10757 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10758 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB10764 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale C JV95 386 HJB10875 | (none) | ------------------------------ |
Hebeloma hiemale C JV04 242 HJB10893 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale C JV95 507 HJB10965 | (none) | ------------------------------ |
Hebeloma hiemale HJB11030 | (none) | ------------------------------ |
Hebeloma hiemale HJB11180 | (none) | ------------------------------ |
Hebeloma hiemale HJB11236 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale BR VJ03072 HJB11499 | (none) | ------------------------------ |
Hebeloma hiemale PDD 88816 HJB11570 | (none) | ------------------------------ |
Hebeloma hiemale K K M 106237 HJB11606 | (none) | ------------------------------ |
Hebeloma hiemale HJB11695 | (none) | ------------------------------ |
Hebeloma hiemale HJB11699 | (none) | ------------------------------ |
Hebeloma hiemale HJB11701 | (none) | ------------------------------ |
Hebeloma hiemale HJB11702 | (none) | ------------------------------ |
Hebeloma hiemale HJB11703 | (none) | ------------------------------ |
Hebeloma hiemale epitype HJB11704 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB11847 | (none) | ------------------------------ |
Hebeloma hiemale E E00244083 HJB11905 | (none) | ------------------------------ |
Hebeloma hiemale HJB11948 | (none) | ------------------------------ |
Hebeloma hiemale HJB11964 | (none) | CT{CT}GCTTTGATGGCCTGCATTTCGGTC |
Hebeloma hiemale HJB11965 | (none) | ------------------------------ |
Hebeloma hiemale HJB12034 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB12202 | (none) | ------------------------------ |
Hebeloma hiemale HJB12210 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale TURA 7490F HJB12369 | (none) | ------------------------------ |
Hebeloma hiemale TURA 7242F HJB12370 | (none) | ------------------------------ |
Hebeloma hiemale HJB12443 | (none) | ------------------------------ |
Hebeloma hiemale AF124703 L WBS9692 HJB13037 | (none) | ------------------------------ |
Hebeloma hiemale AF124707 L HJB13038 | (none) | ------------------------------ |
Hebeloma hiemale HJB12457 | (none) | ------------------------------ |
Hebeloma hiemale ZT ZT6417 HJB12571 | (none) | ------------------------------ |
Hebeloma hiemale HJB13821 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB8455 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB8890 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB8919 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB8920 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB9150 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB9384 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB9479 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma hiemale HJB9527 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma AF124690 ICG19 HJB13035 | (none) | ------------------------------ |
Hebeloma ingratum holotype LY BR64 24 HJB1000040 | (none) | ------------------------------ |
Hebeloma ingratum HJB10283 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma ingratum HJB10284 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma ingratum HJB10298 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma ingratum HJB10600 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma ingratum HJB10797 | (none) | ------------------------------ |
Hebeloma ingratum HJB11198 | (none) | ------------------------------ |
Hebeloma ingratum HJB11311 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma ingratum TUR 8391 HJB12311 | (none) | ------------------------------ |
Hebeloma ingratum L WBS9652 HJB12517 | (none) | ------------------------------ |
Hebeloma ingratum L WBS9573 HJB12534 | (none) | ------------------------------ |
Hebeloma ingratum LOD IK H0192 HJB14163 | (none) | ------------------------------ |
Hebeloma ingratum HJB3809 | (none) | ------------------------------ |
Hebeloma laetitiae isotype K K M 20801 HJB1000003 | (none) | ------------------------------ |
Hebeloma laetitiae holotype ROHB ROHB01093 HJB1000222 | (none) | ------------------------------ |
Hebeloma laetitiae ROHB ROHB01080 HJB12924 | (none) | ------------------------------ |
Hebeloma limbatum HJB10938 | (none) | ------------------------------ |
Hebeloma limbatum C JV05 664 HJB11373 | (none) | CTTGCTTTGATGGC{CT}TGCATTTCGGTC |
Hebeloma limbatum HJB11397 | (none) | ------------------------------ |
Hebeloma limbatum HJB11421 | (none) | ------------------------------ |
Hebeloma limbatum C holotype C F 92311 HJB11858 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma limbatum L WBS9574 HJB12535 | (none) | ------------------------------ |
Hebeloma limbatum GC priv coll GC99101802 HJB12942 | (none) | ------------------------------ |
Hebeloma limbatum LY BR64 21 HJB13356 | (none) | ------------------------------ |
Hebeloma limbatum HJB13380 | (none) | ------------------------------ |
Hebeloma limbatum HJB13386 | (none) | ------------------------------ |
Hebeloma limbatum HJB13421 | (none) | ------------------------------ |
Hebeloma limbatum HJB13682 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma limbatum HJB9423 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma louiseae HJB11984 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma louiseae holotype BR BR MYCO173982 61 HJB12019 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma louiseae HJB12023 | (none) | ------------------------------ |
Hebeloma luteicystidiatum holotype BR BR MYCO166233 72 HJB11837 | (none) | CTTGCTTTGATGGCCTGCATTTCTGTCGGA |
Hebeloma luteicystidiatum HJB12174 | (none) | CTTGCTTTGATGGCCTGCATTTCTGTCGGA |
Hebeloma lutense HJB10523 | (none) | CTGGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma lutense HJB11328 | (none) | CTGGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma lutense HJB11719 | (none) | CTGGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma lutense HJB12126 | (none) | ------------------------------ |
Hebeloma lutense HJB8098 | (none) | CTGGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma lutense HJB9819 | (none) | CTGGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma matritensis holotype HJB9485 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma matritensis HJB9486 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma mediorufum PDD 102997 HJB10687 | (none) | CTGGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma mediorufum PDD 102995 HJB10688 | (none) | CTGGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma mediorufum PDD 102983 HJB10689 | (none) | CTGGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma mediorufum PDD HJB13000 | (none) | ------------------------------ |
Hebeloma minus C JV93 503 HJB10865 | (none) | ------------------------------ |
Hebeloma minus HJB11079 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma minus HJB11107 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma minus HJB11945 | (none) | ------------------------------ |
Hebeloma minus HJB12007 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma minus lowland L WBS9630 HJB12512 | (none) | ------------------------------ |
Hebeloma pallidolabiatum holotype BR BR MYCO174908 17 HJB11992 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma pallidolabiatum HJB12059 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma perexiguum holotype BR BR MYCO173979 58 HJB12038 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma populinum holotype PC 0090762 R59 99 HJB1000030 | (none) | ------------------------------ |
Hebeloma populinum HJB13758 | (none) | CTTGCCTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma populinum HJB14114 | (none) | CTTGCCTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10160 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10162 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10168 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10169 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB10443 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10454 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10458 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes holotype BR BR MYCO174911 20 HJB10468 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10489 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10599 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10601 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10604 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10623 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10626 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10677 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10699 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10704 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10754 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10768 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB10950 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB11183 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB11197 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB11200 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB11225 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB11314 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB11624 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB11627 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB11765 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes AF124710 HJB13039 | (none) | ------------------------------ |
Hebeloma pseudofragilipes E E00159155 HJB11907 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB12112 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB12704 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB12856 | (none) | ------------------------------ |
Hebeloma pseudofragilipes C RE2009 80019 HJB13467 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB13667 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB13730 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB8869 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB8894 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma pseudofragilipes HJB9493 | (none) | ------------------------------ |
Hebeloma pseudofragilipes HJB9879 | (none) | ------------------------------ |
Hebeloma pseudofragilipes K K M 49026 HJB9938 | (none) | ------------------------------ |
Hebeloma pusillum HJB11716 | (none) | ------------------------------ |
Hebeloma pusillum HJB11728 | (none) | CTTGCTTTGATGGCCTGTATTTCGGTCGGA |
Hebeloma pusillum GC priv coll GC07092903 HJB12107 | (none) | CTTGCTTTGATGGCCTGTATTTCGGTCGGA |
Hebeloma pusillum HJB12730 | (none) | CTTGCTTTGATGGCCTGTATTTCGGT{CT} |
Hebeloma pusillum HJB9494 | (none) | CTTGCTTTGATGGCCTGTATTTCGGTCGGA |
Hebeloma rostratum C JV85 936 HJB10819 | (none) | ------------------------------ |
Hebeloma rostratum BR VJ02121 HJB10970 | (none) | ------------------------------ |
Hebeloma rostratum GLM GL43968 HJB11000 | (none) | ------------------------------ |
Hebeloma rostratum BR VJ03089 HJB11507 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma rostratum HJB13009 | (none) | ------------------------------ |
Hebeloma rostratum holotype TURA TUR177056 HJB13086 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma rostratum GC priv coll GC08103003 HJB13139 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma rostratum HJB13664 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma rostratum HJB8897 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma salicicola HJB10260 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma salicicola HJB10422 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma salicicola HJB10427 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma salicicola C JV08 278 HJB12323 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma salicicola holotype BR BR MYCO173977 56 HJB13302 | (none) | CTTGCTTTGATGGCCTGCATATCGGTCGGA |
Hebeloma syrjense C JV05 456 HJB11208 | (none) | CTCGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma syrjense C JV05 509 HJB11210 | (none) | CTCGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma syrjense HJB12064 | (none) | CTCGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma syrjense TURA 26197F HJB12396 | (none) | CTCGCTTTGATGGCGTGCATTTCTGTTGGA |
Hebeloma alvarense hinnuleum holotype C JV95 513 HJB1000121 | (none) | ------------------------------ |
Hebeloma vaccinum cephalotum holotype C C43996 HJB1000247 | (none) | ------------------------------ |
Hebeloma vaccinum HJB10064 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10067 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10068 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10256 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10259 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10587 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10589 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10592 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB10593 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum C JV97 358 HJB10711 | (none) | ------------------------------ |
Hebeloma vaccinum C JV88 859 HJB10713 | (none) | ------------------------------ |
Hebeloma vaccinum C JV91 181 HJB10716 | (none) | ------------------------------ |
Hebeloma vaccinum C JV99 629 HJB10719 | (none) | ------------------------------ |
Hebeloma vaccinum C JV00 504 HJB10722 | (none) | ------------------------------ |
Hebeloma vaccinum HJB10762 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum C JV98 478 HJB10802 | (none) | ------------------------------ |
Hebeloma vaccinum C JV03 731 HJB10910 | (none) | ------------------------------ |
Hebeloma vaccinum C JV93 443 HJB10911 | (none) | ------------------------------ |
Hebeloma vaccinum HJB11318 | (none) | ------------------------------ |
Hebeloma vaccinum HJB11496 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum C JV93 458 HJB11525 | (none) | ------------------------------ |
Hebeloma vaccinum HJB11846 | (none) | ------------------------------ |
Hebeloma vaccinum C JV06 237 HJB11855 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB12190 | (none) | ------------------------------ |
Hebeloma vaccinum HJB12209 | (none) | ------------------------------ |
Hebeloma vaccinum C JV08 425 HJB12348 | (none) | ------------------------------ |
Hebeloma vaccinum L WBS9676 HJB12470 | (none) | ------------------------------ |
Hebeloma vaccinum L WBS9668 HJB12471 | (none) | ------------------------------ |
Hebeloma vaccinum L WBS9669 HJB12472 | (none) | ------------------------------ |
Hebeloma vaccinum L WBS9698 HJB12538 | (none) | ------------------------------ |
Hebeloma vaccinum HJB5115 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Hebeloma vaccinum HJB5119 | (none) | ------------------------------ |
Hebeloma vaccinum HJB9265 | (none) | CTTGCTTT{AG}ATGGCGTGCATTTCGGTC |
Hebeloma vaccinum HJB9962 | (none) | ------------------------------ |
Hebeloma vaccinum HJB9965 | (none) | CTTGCTTTGATGGCCTGCATTTCGGTCGGA |
Columns
None of the columns has a description.