Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 32017 of Study 17842
Citation title: "The Taxonomy of the European Species of Hebeloma section Denudata subsections Hiemalia, Echinospora subsect. nov. and Clepsodroida subsect. nov. and Five New Species".
Study name: "The Taxonomy of the European Species of Hebeloma section Denudata subsections Hiemalia, Echinospora subsect. nov. and Clepsodroida subsect. nov. and Five New Species".
This study is part of submission 17842
(Status: Published).
Matrices
Title: Hebeloma sect. Denudata Tef1a
Description: Hebeloma sect. Denudata Tef1a
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Hebeloma aanenii HJB10164 | (none) | ------------------------------ |
| Hebeloma aanenii HJB10282 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma aanenii HJB10607 | (none) | ------------------------------ |
| Hebeloma aanenii UPS AT2003063 HJB10670 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma aanenii holotype BR BRMYCO 173987 66 HJB12630 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma alpinum HJB11051 | (none) | ------------------------------ |
| Hebeloma alpinum HJB10642 | (none) | ------------------------------ |
| Hebeloma alpinum HJB11085 | (none) | ------------------------------ |
| Hebeloma alpinum HJB11094 | (none) | TGGTACTTCTCAGGCTGATTGTGCCGTTCT |
| Hebeloma alpinum HJB11117 | (none) | TGGCACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma alpinum HJB11132 | (none) | TGGTACTTCTCAGGCTGATTGTGCCGTTCT |
| Hebeloma alpinum HJB12005 | (none) | TGGTACTTCTCAGGCTGATTGTGCCGTTCT |
| Hebeloma alpinum HJB13096 | (none) | ------------------------------ |
| Hebeloma ammophilum holotype BP 56934 HJB1000051 | (none) | ------------------------------ |
| Hebeloma ammophilum HJB10803 | (none) | ------------------------------ |
| Hebeloma ammophilum HJB11527 | (none) | ------------------------------ |
| Hebeloma ammophilum GB EL281 08 HJB12374 | (none) | TGGCACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma aurantioumbrinum C JV00 291 HJB10906 | (none) | ------------------------------ |
| Hebeloma aurantioumbrinum HJB11934 | (none) | ------------------------------ |
| Hebeloma aurantioumbrinum HJB12012 | (none) | ------------------------------ |
| Hebeloma aurantioumbrinum holotype BR BRMYCO173985 64 HJB12058 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma aurantioumbrinum HJB12445 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma litoreum holotype K K M 0802 HJB1000004 | (none) | ------------------------------ |
| Hebeloma cavipes holotype L L960 110 524 HJB1000010 | (none) | ------------------------------ |
| Hebeloma alvarense holotype TUR 17955F HJB1000120 | (none) | ------------------------------ |
| Hebeloma vejlense holotype C JV00 251 HJB1000132 | (none) | ------------------------------ |
| Hebeloma litoreum holotype ROHB 01313 HJB1000225 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10331 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10336 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10337 | (none) | ------------------------------ |
| Hebeloma cavipes C JV04 579 HJB10343 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10451 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10453 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10524 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10537 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma cavipes HJB10544 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10548 | (none) | ------------------------------ |
| Hebeloma cavipes PDD 102993 HJB10691 | (none) | ------------------------------ |
| Hebeloma cavipes C JV04 637 HJB10709 | (none) | ------------------------------ |
| Hebeloma cavipes C JV99 511 HJB10718 | (none) | ------------------------------ |
| Hebeloma cavipes C JV03 507 HJB10720 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10796 | (none) | ------------------------------ |
| Hebeloma cavipes HJB10804 | (none) | ------------------------------ |
| Hebeloma cavipes C JV00 690 HJB10900 | (none) | ------------------------------ |
| Hebeloma cavipes C JV92 298 HJB10951 | (none) | ------------------------------ |
| Hebeloma cavipes BR VJ00071 HJB10973 | (none) | ------------------------------ |
| Hebeloma cavipes GLM GL42741 HJB10997 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11305 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11379 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11403 | (none) | ------------------------------ |
| Hebeloma cavipes C JV05 720 HJB11405 | (none) | ------------------------------ |
| Hebeloma cavipes C JV05 792 HJB11428 | (none) | ------------------------------ |
| Hebeloma cavipes C JV05 791 HJB11429 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11621 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11746 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11747 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11750 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11758 | (none) | ------------------------------ |
| Hebeloma cavipes HJB11791 | (none) | ------------------------------ |
| Hebeloma cavipes C JV06 593 HJB11843 | (none) | ------------------------------ |
| Hebeloma cavipes TURA 25408 HJB12305 | (none) | ------------------------------ |
| Hebeloma cavipes C JV08 118 HJB12320 | (none) | ------------------------------ |
| Hebeloma cavipes C JV08 353 HJB12345 | (none) | ------------------------------ |
| Hebeloma cavipes C JV08 350 HJB12346 | (none) | ------------------------------ |
| Hebeloma cavipes C JV08 254 HJB12349 | (none) | ------------------------------ |
| Hebeloma cavipes C JV87 407 HJB12352 | (none) | ------------------------------ |
| Hebeloma cavipes C JV89 1334 HJB12354 | (none) | ------------------------------ |
| Hebeloma cavipes C JV93 317 HJB12357 | (none) | ------------------------------ |
| Hebeloma cavipes C JV85 615 HJB12358 | (none) | ------------------------------ |
| Hebeloma cavipes C JV84 1298 HJB12360 | (none) | ------------------------------ |
| Hebeloma cavipes C JV94 1013 HJB12363 | (none) | ------------------------------ |
| Hebeloma cavipes C JV93 1067 HJB12365 | (none) | ------------------------------ |
| Hebeloma cavipes C JV86 489 HJB12414 | (none) | ------------------------------ |
| Hebeloma cavipes L WBS9427 HJB12482 | (none) | ------------------------------ |
| Hebeloma cavipes HJB12603 | (none) | ------------------------------ |
| Hebeloma cavipes HJB12664 | (none) | ------------------------------ |
| Hebeloma cavipes HJB12673 | (none) | ------------------------------ |
| Hebeloma cavipes HJB12688 | (none) | ------------------------------ |
| Hebeloma cavipes C JV08 513 HJB12800 | (none) | ------------------------------ |
| Hebeloma cavipes C Larsen227 2007 HJB13006 | (none) | ------------------------------ |
| Hebeloma cavipes C H5 06 HJB13074 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13217 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13282 | (none) | ------------------------------ |
| Hebeloma cavipes C JV09 743LSa2009 79355 HJB13437 | (none) | ------------------------------ |
| Hebeloma cavipes S F28516 HJB13468 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13498 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13722 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13723 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13725 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13726 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13729 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13733 | (none) | ------------------------------ |
| Hebeloma cavipes HJB13873 | (none) | ------------------------------ |
| Hebeloma cavipes HJB8105 | (none) | ------------------------------ |
| Hebeloma cavipes HJB9380 | (none) | ------------------------------ |
| Hebeloma cavipes HJB9433 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma cavipes HJB9878 | (none) | ------------------------------ |
| Hebeloma crustuliniforme HJB11237 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma crustuliniforme L WBS9689 HJB12481 | (none) | ------------------------------ |
| Hebeloma crustuliniforme L WBS9581 HJB12807 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma crustuliniforme L WBS9546 HJB12811 | (none) | ------------------------------ |
| Hebeloma crustuliniforme epitype BR BR MYCO173989 68 HJB13713 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma crustuliniforme HJB9053 | (none) | ------------------------------ |
| Hebeloma eburneum HJB10290 | (none) | TGGTACTTCTCAGGCTGA{CT}TGTGCCAT |
| Hebeloma eburneum HJB10525 | (none) | ------------------------------ |
| Hebeloma eburneum L WBS9511 HJB12501 | (none) | ------------------------------ |
| Hebeloma eburneum HJB12670 | (none) | TGGTACTTCTCAGGCTGA{CT}TGTGCCAT |
| Hebeloma eburneum C JV08 451 HJB12769 | (none) | ------------------------------ |
| Hebeloma eburneum L WBS9686 HJB12996 | (none) | ------------------------------ |
| Hebeloma eburneum HJB9267 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma echinosporum holotype BR BR MYCO174907 16 HJB13524 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma fragilipes holotype PC PC0090764 R63 179 HJB1000031 | (none) | ------------------------------ |
| Hebeloma fragilipes HJB10567 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma fragilipes HJB10568 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma fragilipes HJB11435 | (none) | TGGTACTTCCCAGGC{CT}GATTGTGCCAT |
| Hebeloma fragilipes HJB11720 | (none) | TGGTACTTCCCAGGC{CT}GATTGTGCCAT |
| Hebeloma fragilipes HJB11737 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma fragilipes TURA 11957 HJB12392 | (none) | ------------------------------ |
| Hebeloma fragilipes HJB12608 | (none) | ------------------------------ |
| Hebeloma fragilipes L WBS9694 HJB12802 | (none) | ------------------------------ |
| Hebeloma fragilipes HJB13277 | (none) | TGGTACTTCCCAGGC{CT}GATTGTGCCAT |
| Hebeloma fragilipes HJB13344 | (none) | ------------------------------ |
| Hebeloma fragilipes HJB13614 | (none) | ------------------------------ |
| Hebeloma geminatum HJB10384 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma geminatum holotype C C F 90152 HJB10833 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma geminatum TURA 17928F HJB10961 | (none) | ------------------------------ |
| Hebeloma geminatum HJB12655 | (none) | ------------------------------ |
| Hebeloma geminatum HJB8633 | (none) | -----------------------------T |
| Hebeloma helodes HJB10606 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma helodes HJB10680 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma helodes HJB11698 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma helodes HJB12634 | (none) | ------------------------------ |
| Hebeloma helodes HJB8115 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma helodes HJB8816 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma oculatum holotype LY BR64 29 HJB1000039 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10130 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10163 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10296 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10370 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10440 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10464 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10469 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10472 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10484 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10539 | (none) | TGGTACTTCTCAGGCCGATTGTGCCATTCT |
| Hebeloma hiemale HJB10702 | (none) | ------------------------------ |
| Hebeloma hiemale C JHC00 067 HJB10724 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10756 | (none) | ------------------------------ |
| Hebeloma hiemale HJB10757 | (none) | TGGTACTTCTCAGGC{CT}GATTGTGCCAT |
| Hebeloma hiemale HJB10758 | (none) | TGGTACTTCTCAGGCCGATTGTGCCATTCT |
| Hebeloma hiemale HJB10764 | (none) | ------------------------------ |
| Hebeloma hiemale C JV95 386 HJB10875 | (none) | ------------------------------ |
| Hebeloma hiemale C JV04 242 HJB10893 | (none) | ------------------------------ |
| Hebeloma hiemale C JV95 507 HJB10965 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11030 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11180 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11236 | (none) | TGGTACTTCTCAGGC{CT}GATTGTGCCAT |
| Hebeloma hiemale BR VJ03072 HJB11499 | (none) | ------------------------------ |
| Hebeloma hiemale PDD 88816 HJB11570 | (none) | ------------------------------ |
| Hebeloma hiemale K K M 106237 HJB11606 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11695 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11699 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11701 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11702 | (none) | TGGTACTTCTCAGGCCGATTGTGCCATTCT |
| Hebeloma hiemale HJB11703 | (none) | ------------------------------ |
| Hebeloma hiemale epitype HJB11704 | (none) | TGGTACTTCTCAGGC{CT}GATTGTGCCAT |
| Hebeloma hiemale HJB11847 | (none) | ------------------------------ |
| Hebeloma hiemale E E00244083 HJB11905 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11948 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11964 | (none) | ------------------------------ |
| Hebeloma hiemale HJB11965 | (none) | ------------------------------ |
| Hebeloma hiemale HJB12034 | (none) | ------------------------------ |
| Hebeloma hiemale HJB12202 | (none) | TGGTACTTCTCAGGC{CT}GATTGTGCC{A |
| Hebeloma hiemale HJB12210 | (none) | ------------------------------ |
| Hebeloma hiemale TURA 7490F HJB12369 | (none) | ------------------------------ |
| Hebeloma hiemale TURA 7242F HJB12370 | (none) | ------------------------------ |
| Hebeloma hiemale HJB12443 | (none) | ------------------------------ |
| Hebeloma hiemale AF124703 L WBS9692 HJB13037 | (none) | ------------------------------ |
| Hebeloma hiemale AF124707 L HJB13038 | (none) | ------------------------------ |
| Hebeloma hiemale HJB12457 | (none) | ------------------------------ |
| Hebeloma hiemale ZT ZT6417 HJB12571 | (none) | ------------------------------ |
| Hebeloma hiemale HJB13821 | (none) | ------------------------------ |
| Hebeloma hiemale HJB8455 | (none) | ------------------------------ |
| Hebeloma hiemale HJB8890 | (none) | TGGTACTTCTCAGGCCGATTGTGCCATTCT |
| Hebeloma hiemale HJB8919 | (none) | ------------------------------ |
| Hebeloma hiemale HJB8920 | (none) | TGGTACTTCTCAGGC{CT}GATTGTGCCAT |
| Hebeloma hiemale HJB9150 | (none) | TGGTACTTCTCAGGC{CT}GATTGTGCCAT |
| Hebeloma hiemale HJB9384 | (none) | TGG{CG}ACTTCTCAGGCTGA{CG}TGTGC |
| Hebeloma hiemale HJB9479 | (none) | ------------------------------ |
| Hebeloma hiemale HJB9527 | (none) | ------------------------------ |
| Hebeloma AF124690 ICG19 HJB13035 | (none) | ------------------------------ |
| Hebeloma ingratum holotype LY BR64 24 HJB1000040 | (none) | ------------------------------ |
| Hebeloma ingratum HJB10283 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma ingratum HJB10284 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma ingratum HJB10298 | (none) | TGGTACTTCTCAGGCTGATTGTGCCAT{CT |
| Hebeloma ingratum HJB10600 | (none) | ------------------------------ |
| Hebeloma ingratum HJB10797 | (none) | ------------------------------ |
| Hebeloma ingratum HJB11198 | (none) | ------------------------------ |
| Hebeloma ingratum HJB11311 | (none) | ------------------------------ |
| Hebeloma ingratum TUR 8391 HJB12311 | (none) | ------------------------------ |
| Hebeloma ingratum L WBS9652 HJB12517 | (none) | ------------------------------ |
| Hebeloma ingratum L WBS9573 HJB12534 | (none) | ------------------------------ |
| Hebeloma ingratum LOD IK H0192 HJB14163 | (none) | ------------------------------ |
| Hebeloma ingratum HJB3809 | (none) | ------------------------------ |
| Hebeloma laetitiae isotype K K M 20801 HJB1000003 | (none) | ------------------------------ |
| Hebeloma laetitiae holotype ROHB ROHB01093 HJB1000222 | (none) | ------------------------------ |
| Hebeloma laetitiae ROHB ROHB01080 HJB12924 | (none) | ------------------------------ |
| Hebeloma limbatum HJB10938 | (none) | ------------------------------ |
| Hebeloma limbatum C JV05 664 HJB11373 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma limbatum HJB11397 | (none) | ------------------------------ |
| Hebeloma limbatum HJB11421 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma limbatum C holotype C F 92311 HJB11858 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma limbatum L WBS9574 HJB12535 | (none) | ------------------------------ |
| Hebeloma limbatum GC priv coll GC99101802 HJB12942 | (none) | ------------------------------ |
| Hebeloma limbatum LY BR64 21 HJB13356 | (none) | ------------------------------ |
| Hebeloma limbatum HJB13380 | (none) | ------------------------------ |
| Hebeloma limbatum HJB13386 | (none) | ------------------------------ |
| Hebeloma limbatum HJB13421 | (none) | ------------------------------ |
| Hebeloma limbatum HJB13682 | (none) | ------------------------------ |
| Hebeloma limbatum HJB9423 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma louiseae HJB11984 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma louiseae holotype BR BR MYCO173982 61 HJB12019 | (none) | ------------------------------ |
| Hebeloma louiseae HJB12023 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma luteicystidiatum holotype BR BR MYCO166233 72 HJB11837 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma luteicystidiatum HJB12174 | (none) | ------------------------------ |
| Hebeloma lutense HJB10523 | (none) | TAGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma lutense HJB11328 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma lutense HJB11719 | (none) | ------------------------------ |
| Hebeloma lutense HJB12126 | (none) | ------------------------------ |
| Hebeloma lutense HJB8098 | (none) | ------------------------------ |
| Hebeloma lutense HJB9819 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma matritensis holotype HJB9485 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma matritensis HJB9486 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma mediorufum PDD 102997 HJB10687 | (none) | ------------------------------ |
| Hebeloma mediorufum PDD 102995 HJB10688 | (none) | TGGTACTT{CT}TCAGGCTGATTGTGCCAT |
| Hebeloma mediorufum PDD 102983 HJB10689 | (none) | TGGTACCTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma mediorufum PDD HJB13000 | (none) | ------------------------------ |
| Hebeloma minus C JV93 503 HJB10865 | (none) | ------------------------------ |
| Hebeloma minus HJB11079 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma minus HJB11107 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma minus HJB11945 | (none) | ------------------------------ |
| Hebeloma minus HJB12007 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma minus lowland L WBS9630 HJB12512 | (none) | ------------------------------ |
| Hebeloma pallidolabiatum holotype BR BR MYCO174908 17 HJB11992 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma pallidolabiatum HJB12059 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma perexiguum holotype BR BR MYCO173979 58 HJB12038 | (none) | TGGTACTTCTCAGGCTGATTGTGCCGTTCT |
| Hebeloma populinum holotype PC 0090762 R59 99 HJB1000030 | (none) | ------------------------------ |
| Hebeloma populinum HJB13758 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma populinum HJB14114 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma pseudofragilipes HJB10160 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10162 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10168 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10169 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10443 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10454 | (none) | TGGTACTTCCCAGGCTGATTGTGC{AC}AT |
| Hebeloma pseudofragilipes HJB10458 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes holotype BR BR MYCO174911 20 HJB10468 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10489 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10599 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10601 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10604 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10623 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10626 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10677 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB10699 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10704 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10754 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10768 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB10950 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB11183 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB11197 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB11200 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB11225 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB11314 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB11624 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB11627 | (none) | TGGTACTTC{CT}CAGGCCGATTGTGCCAT |
| Hebeloma pseudofragilipes HJB11765 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes AF124710 HJB13039 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes E E00159155 HJB11907 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB12112 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB12704 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB12856 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes C RE2009 80019 HJB13467 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB13667 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB13730 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB8869 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB8894 | (none) | TGGTACTTCCCAGGCTGATTGTGCCATTCT |
| Hebeloma pseudofragilipes HJB9493 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes HJB9879 | (none) | ------------------------------ |
| Hebeloma pseudofragilipes K K M 49026 HJB9938 | (none) | ------------------------------ |
| Hebeloma pusillum HJB11716 | (none) | ------------------------------ |
| Hebeloma pusillum HJB11728 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma pusillum GC priv coll GC07092903 HJB12107 | (none) | ------------------------------ |
| Hebeloma pusillum HJB12730 | (none) | ------------------------------ |
| Hebeloma pusillum HJB9494 | (none) | ------------------------------ |
| Hebeloma rostratum C JV85 936 HJB10819 | (none) | ------------------------------ |
| Hebeloma rostratum BR VJ02121 HJB10970 | (none) | ------------------------------ |
| Hebeloma rostratum GLM GL43968 HJB11000 | (none) | ------------------------------ |
| Hebeloma rostratum BR VJ03089 HJB11507 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma rostratum HJB13009 | (none) | ------------------------------ |
| Hebeloma rostratum holotype TURA TUR177056 HJB13086 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma rostratum GC priv coll GC08103003 HJB13139 | (none) | ------------------------------ |
| Hebeloma rostratum HJB13664 | (none) | ------------------------------ |
| Hebeloma rostratum HJB8897 | (none) | TGGTACTTCTCAGGCTGATTGCGCCATTCT |
| Hebeloma salicicola HJB10260 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma salicicola HJB10422 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma salicicola HJB10427 | (none) | ------------------------------ |
| Hebeloma salicicola C JV08 278 HJB12323 | (none) | ------------------------------ |
| Hebeloma salicicola holotype BR BR MYCO173977 56 HJB13302 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma syrjense C JV05 456 HJB11208 | (none) | ------------------------------ |
| Hebeloma syrjense C JV05 509 HJB11210 | (none) | T{GT}GAACTTCTCAGGCTGATTGCGCTAT |
| Hebeloma syrjense HJB12064 | (none) | TGGAACTTCTCAGGCTGATTGCGCTATCCT |
| Hebeloma syrjense TURA 26197F HJB12396 | (none) | TGGAACTTCTCAGGCTGATTGCGCTATCCT |
| Hebeloma alvarense hinnuleum holotype C JV95 513 HJB1000121 | (none) | ------------------------------ |
| Hebeloma vaccinum cephalotum holotype C C43996 HJB1000247 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10064 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10067 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
| Hebeloma vaccinum HJB10068 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10256 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10259 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10587 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10589 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10592 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10593 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV97 358 HJB10711 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV88 859 HJB10713 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV91 181 HJB10716 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV99 629 HJB10719 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV00 504 HJB10722 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB10762 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV98 478 HJB10802 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV03 731 HJB10910 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV93 443 HJB10911 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB11318 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB11496 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV93 458 HJB11525 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB11846 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV06 237 HJB11855 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB12190 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB12209 | (none) | ------------------------------ |
| Hebeloma vaccinum C JV08 425 HJB12348 | (none) | ------------------------------ |
| Hebeloma vaccinum L WBS9676 HJB12470 | (none) | ------------------------------ |
| Hebeloma vaccinum L WBS9668 HJB12471 | (none) | ------------------------------ |
| Hebeloma vaccinum L WBS9669 HJB12472 | (none) | ------------------------------ |
| Hebeloma vaccinum L WBS9698 HJB12538 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB5115 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB5119 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB9265 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB9962 | (none) | ------------------------------ |
| Hebeloma vaccinum HJB9965 | (none) | TGGTACTTCTCAGGCTGATTGTGCCATTCT |
Columns
None of the columns has a description.
