@ARTICLE{TreeBASE2Ref24805,
author = {Belinda Kahnt and Michael Gerth and Robert John Paxton and Christoph Bleidorn and Martin Husemann},
title = {The complete mitochondrial genome of the endemic and highly specialised South African bee species: Rediviva intermixta (Hymenoptera: Melittidae), with a comparison to other bee mitogenomes},
year = {2015},
keywords = {Mitochondrion, mitogenome, phylogeny, bees, Apis, Bombus, NGS},
doi = {},
url = {http://},
pmid = {},
journal = {Biological Journal of the Linnean Society},
volume = {},
number = {},
pages = {},
abstract = {We describe the complete mitochondrial genome (mitogenome) of the South African bee Rediviva intermixta, the first mitogenomic data for a species belonging to the basally branching bee family (Melittidae), and compare it to other published bee (Anthophila) mitogenomes. The mitogenome of R. intermixta is 16,875 bp long, shows the highest GC content (20.1%) of all studied bee mitogenomes, and contains the typical set of 37 genes. The order of protein-coding and rRNA genes is highly conserved across Anthophila, but several tRNA rearrangements have occurred. These were mostly observed in the first and sixth (nad3-nad5 junction) tRNA clusters, which are considered rearrangement hotspots in other taxa. All protein-coding genes contained the common start and stop codons, with cox2 and nad1 having two consecutive stop codons. The mean genetic distance between R. intermixta and the other Anthophila ranged from 29% to 33%. Phylogenetic analysis of the whole mitogenome supported R. intermixta and Colletidae as sister group to all other apid species. The discordance among gene sequences in phylogenetic signal detected allows selection of mitochondrial genes with greater information content for future phylogenetic analyses.}
}
Matrix 32216 of Study 17896

Citation title:
"The complete mitochondrial genome of the endemic and highly specialised South African bee species: Rediviva intermixta (Hymenoptera: Melittidae), with a comparison to other bee mitogenomes".

Study name:
"The complete mitochondrial genome of the endemic and highly specialised South African bee species: Rediviva intermixta (Hymenoptera: Melittidae), with a comparison to other bee mitogenomes".

This study is part of submission 17896
(Status: Published).
Matrices
Title: Melittidae nad4l_raxml
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Apis andreniformis |
(none)
|
TAAAGATAGGCCTAATACTAATTCACAAAC |
Apis florea |
(none)
|
TAAAGATAACCCTAAAACTAATTCACAAAC |
Apis cerana |
(none)
|
CAGTGACAAACCTAAAACTAATTCACAAAC |
Apis mellifera ligustica |
(none)
|
TAATGATAAACCTAAAACTAACTCACATAC |
Apis mellifera mellifera |
(none)
|
TAATGATAAACCTAAAACTAACTCACATAC |
Apis mellifera scutellata |
(none)
|
TAATGATAAACCTAAAACTAACTCACATAC |
Bombus hypocrita sapporensis |
(none)
|
CAATGATAACCCTAATACTCTTTCACATAC |
Bombus ignitus |
(none)
|
TAATGATAAACCTAATACTCTTTCACATAC |
Melipona bicolor |
(none)
|
TAATAATAATCCTAAAATTCCTTCACATAC |
Rediviva intermixta |
(none)
|
TAATACAAGCCCTATAACTCTTTCACAGAC |
Philanthus triangulum |
(none)
|
TAAAGCCAATCCTATAATTCTTTCACAAAC |
Polistes sp. |
(none)
|
AAAACTAATTCCAATAACTCCCTCAATAAC |
Hylaeus dilatatus |
(none)
|
TAAAGACATGCCAATTACTCTTTCACAAAC |
Colletes gigas |
(none)
|
AAGGCTAAATCCAAACACTCTTTCCCAAAC |
Columns
None of the columns has a description.