CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 32222 of Study 17896

About Citation title: "The complete mitochondrial genome of the endemic and highly specialised South African bee species: Rediviva intermixta (Hymenoptera: Melittidae), with a comparison to other bee mitogenomes".
About Study name: "The complete mitochondrial genome of the endemic and highly specialised South African bee species: Rediviva intermixta (Hymenoptera: Melittidae), with a comparison to other bee mitogenomes".
About This study is part of submission 17896 (Status: Published).

Matrices

Title: Melittidae rrnL_raxml

Rows

Taxon Label Row Segments Characters 1?–30
Apis andreniformis  (none) AAATAAC------------TTTTAATTATT
Apis florea  (none) AAATAAC---------------AATTTATT
Apis mellifera ligustica  (none) AAATAAC----------TATATAATATATT
Apis mellifera mellifera  (none) AAATAAC----------TATATAATATATT
Apis mellifera scutellata  (none) AAATAAC----------TATATAATATATT
Apis cerana  (none) AAATAAT---------CAAATTAATATATT
Bombus hypocrita sapporensis  (none) ATATAAT-------TATATTAATATTTATT
Bombus ignitus  (none) ATATAATTTATTTATATTTATACATGTATA
Melipona bicolor  (none) AAATAAT------------AATTATTTATT
Rediviva intermixta  (none) AGATAAT--------------AAATTGATT
Philanthus triangulum  (none) AAATAAC---------AAAATTTATATTTA
Polistes sp.  (none) AATTAAT-------------------TATA
Colletes gigas  (none) AAATAAT---------AAACTAAATATATT
Hylaeus dilatatus  (none) AAGTAAT-------------------TATA

Columns

None of the columns has a description.