@ARTICLE{TreeBASE2Ref25644,
author = {Yu Ito and Norio Tanaka and A. Muthama Muasya and Pablo Garc?a-Murillo},
title = {A new delimitation of the Afro-Eurasian plant genus Althenia to include its Australasian relative, Lepilaena (Potamogetonaceae) ? evidence from DNA and morphological data.},
year = {2016},
keywords = {Ancestral state reconstruction; Biogeography; Disjunct distribution; Molecular dating; Monocots; Taxonomy},
doi = {10.1016/j.ympev.2016.02.008},
url = {http://},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Althenia (Potamogetonaceae) is an aquatic plant genus disjunctly distributed in the southern- (South Africa?s Cape Floristic Region: CFR) and northern- (Mediterranean Eurasia) hemispheres. This genus and its Australasian relative, Lepilaena, share similar floral characters yet have been treated as different genera or sections of Althenia sensu lato (s.l.) due to the isolated geographic distribution as well as the differences in sex expression, stamen construction, and stigma morphology. The diagnostic characters, however, need reevaluation over the boundaries between the entities. Here we tested the taxonomic delimitation between the entities, assessed synapomorphies for evolutionary lineages, and inferred biogeographic history in a phylogenetic framework. Our results indicated that Lepilaena was resolved as non-monophyletic in both plastid DNA and nuclear PhyC trees and Althenia was nested within it. As Althenia has nomenclatural priority, we propose a new delimitation to recognize Althenia s.l., which can be diagnosed by the female flowers with 3-segmented perianths and male flowers with perianths. The previously used diagnostic characters are either autapomorphies or synapomorphies for small lineages within Althenia s.l., and evolutionary transitions to sessile female flowers and narrow leaves characterize larger clades. Biogeographic analyses suggested a Miocene origin of Althenia s.l. in Australasia and indicated at least one inter- and one intra-specific inter-continental dispersal events among Australasia, Mediterranean Eurasia, and South Africa?s CFR need to be hypothesized to explain the current distribution patterns.}
}
Matrix 32324 of Study 17935

Citation title:
"A new delimitation of the Afro-Eurasian plant genus Althenia to include its Australasian relative, Lepilaena (Potamogetonaceae) ? evidence from DNA and morphological data.".

Study name:
"A new delimitation of the Afro-Eurasian plant genus Althenia to include its Australasian relative, Lepilaena (Potamogetonaceae) ? evidence from DNA and morphological data.".

This study is part of submission 17935
(Status: Published).
Matrices
Title: Althenia matkndhfrbclrpobrpoc1phyc_Bayes
Description: matkndhfrbclrpobrpoc1phyc_Bayes
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Zostera marina YI1983 |
(none)
|
TAAAAATGGAACATCTTGCTGTAGTTTTTT |
Potamogeton distinctus YI1686 |
(none)
|
GAAAAATAGAACGTCTTGCAGTAGTTTTTC |
Althenia filiformis YI1977 |
(none)
|
TAAAAGTAGAGCGTCTTACAGTAATTTTTT |
Althenia orientalis YI1562 |
(none)
|
TAAAAGTAGAGCGTCTTACAGTAATTTTTT |
Lepilaena australis YI1917 |
(none)
|
TAAAAATCGAACGTCTTACGGTAATTTTTT |
Lepilaena bilocularis YI1918 |
(none)
|
TAAAAATAGAACGTCTTATGGTAATTTTTT |
Lepilaena cylindrocarpa YI1106 |
(none)
|
TAAAAATAGAACGTCTTACAGTAATTTTTT |
Lepilaena marina YI1920 |
(none)
|
TAAAAATAGAACGTCTTACGGTAATTTTTT |
Lepilaena preissii YI1082 |
(none)
|
TAAAAATGGAACGTCTTACAGTAATTTTTT |
Pseudalthenia aschersoniana YI1981 |
(none)
|
TAAAAATAGAACGTCTTACGGTAATTTTTT |
Zannichellia peltata YI1470 |
(none)
|
TAAAAATAGAACGTCTTGCGGTAATTTTTT |
Zannichellia obtusifolia YI1542 |
(none)
|
TAAAAATCGAACGTCTTGCGATAATTTTTT |
Zannichellia pedunculata YI1344 |
(none)
|
TAAAAATAGAACGTCTTGCGGTAATTTTTT |
Zannichellia palustris YI1473 |
(none)
|
TAAAAATAGAACGTCTTGCGGTAATTTTTT |
Columns
None of the columns has a description.