@ARTICLE{TreeBASE2Ref15074,
	 author = {Annemarie  Costello and Timothy J.  Motley},
	 title = {Phylogenetics of the Tetraplasandra Group (Araliaceae) inferred from ITS, 5S-NTS, and morphology},
	 year = {2007},
	 keywords = {},
	 doi = {},
	 url = {},
	 pmid = {},
	 journal = {Systematic Botany},
	 volume = {},
	 number = {},
	 pages = {},
	 abstract = {Tetraplasandra, Reynoldsia, and Munroidendron form a complex of closely related genera (14 species) distributed from Tahiti, Samoa, and the Marquesas, to the Hawaiian archipelago. In this paper, we investigate evolutionary relationships within this group using morphological and DNA sequence variation to test the monophyly of the Hawaiian species (the Tetraplasandra group), generic limits of Tetraplasandra, Reynoldsia, and Munroidendron, and the validity of current classifications. Parsimony analyses using two molecular markers, the internal transcribed spacer (ITS) and the 5S non-transcribed spacer (5S-NTS) of the nuclear rDNA genes, and 39 morphological and anatomical characters were conducted using all species of Tetraplasandra (excluding the recently resurrected species T. lydgatei), Reynoldsia, and Munroidendron, plus three species (four for morphological data) of the outgroup genus Gastonia. The results support a monophyletic Hawaiian Tetraplasandra group, a sister relationship between Munroidendron and R. sandwicensis, and a polyphyletic Reynoldsia. Here we build on previous molecular analyses of the Tetraplasandra group and propose the next steps necessary to recognize new generic boundaries. Changes in floral morphology within Tetraplasandra correspond to monophyletic groupings. Species with hypogynous flowers cluster together and species with floral characters suggestive of ornithophily cluster together.}
}
Matrix 1880 of  Study 1798
	
	
		
		Citation title: 
"Phylogenetics of the Tetraplasandra Group (Araliaceae) inferred from ITS, 5S-NTS, and morphology".
	
 
	
		
			
	
			This study was previously identified under the legacy study ID S1771  
			(Status: Published).
		
 
	
	
 
Matrices
	Title: 5S data
	Description: Legacy TreeBASE Matrix ID = M3234
	
	
	
	
	
	
	
	
	
	
	
	
	
	
	
	
	
Rows
| 
Taxon Label | 
Row Segments | 
Characters 1?–30 | 
| Tetraplasandra waimeae | 
		
	
					 (none)
				
		
	 | 
CCCGTGAGGGTTATCTCTTTTTATTTCTAT | 
| Tetraplasandra waialealae | 
		
	
					 (none)
				
		
	 | 
CCCGCTAGGGTTATCTCTTTTTATTTCTAT | 
| Tetraplasandra oahuensis | 
		
	
					 (none)
				
		
	 | 
CCCGCTAGGGTTATCTCTTTTTATTTCTAT | 
| Tetraplasandra kavaiensis | 
		
	
					 (none)
				
		
	 | 
CCCGCTAGGGTTCTCTCTTTTTATTGATAT | 
| Tetraplasandra hawaiensis | 
		
	
					 (none)
				
		
	 | 
CCCGCAAGGGTTCTCTCTTTTTATTTCTAT | 
| Tetraplasandra gymnocarpa | 
		
	
					 (none)
				
		
	 | 
CCCGCTAGGGTTCTCTCTTTTTATTTATAT | 
| Tetraplasandra flynnii | 
		
	
					 (none)
				
		
	 | 
CCCGCTAGGGTTCTCTCTTTTTATTTATAT | 
| Tetraplasandra bisattenuata | 
		
	
					 (none)
				
		
	 | 
CCCGCTAGGGTTATCTCTTTT-ATTTCTAT | 
| Reynoldsia verrucosa | 
		
	
					 (none)
				
		
	 | 
CCCGTTAGGGTTATCAGGTTTTACTGCTAT | 
| Reynoldsia sandwicensis | 
		
	
					 (none)
				
		
	 | 
CCCGCTAAGGTTTTCTTTTTTTATTCCTAT | 
| Reynoldsia pleiosperma | 
		
	
					 (none)
				
		
	 | 
--CGTTAGGGTTATCCGTTTTTACTGCTAT | 
| Reynoldsia marchionensis | 
		
	
					 (none)
				
		
	 | 
-CCGTTAGG-TTATCAGTTTTTACTGCTGT | 
| Reynoldsia lanutoensis | 
		
	
					 (none)
				
		
	 | 
-CCCGTAGG-T-ATC-CGTTTTACTGCT-T | 
| Munroidendron racemosum | 
		
	
					 (none)
				
		
	 | 
----------CTTTTTTCTTTTATTCCTAT | 
| Gastonia spectabilis | 
		
	
					 (none)
				
		
	 | 
--CCGTAGG-TTATCCGTTTTTACTACTAT | 
| Gastonia rodriguesiana | 
		
	
					 (none)
				
		
	 | 
ACCGTCAGGGTTATCCGGTTTTACTTCTAT | 
| Gastonia mauritiana | 
		
	
					 (none)
				
		
	 | 
CCCGTTAGGGTTATCCGTTTTTACTTCTAT | 
Columns
None of the columns has a description.