@ARTICLE{TreeBASE2Ref14672,
author = {Jean Carlson Batzer and Maria Mercedes Diaz Arias and Thomas C. Harrington and Mark L. Gleason and Pedro W. Crous},
title = {Four species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple},
year = {2007},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {Sooty blotch and flyspeck (SBFS) are late-season blemishes of apple and pear fruit that cosmetically damage the cuticle, resulting in produce that is unacceptable to consumers. Previous studies reported that a single, wide-host-range species, Schizothyrium pomi (presumed anamorph: Zygophiala jamaicensis), caused flyspeck on apple. In the present study we compared morphology and DNA phylogeny (ITS, LSU) of 139 fungal strains isolated from flyspeck signs from 39 apple orchards in 14 Midwestern and eastern states (USA). Parsimony analysis, supported by cultural characteristics and morphology in vitro, provided support to delimit the flyspeck isolates into four species of Zygophiala, two of which are known to be sexual. Three of these species are described as new. Based on DNA phylogeny, species of Schizothyrium were shown to cluster with members of the genus Mycosphaerella in the Capnodiales, having similar asci and ascospores but morphologically distinct ascomata. These data question the value of ascomatal morphology at the ordinal level, although it appears to still be relevant at the family level, delimiting the thyrothecial Schizothyriaceae from other families in the Capnodiales.}
}
Matrix 1507 of Study 1813

Citation title:
"Four species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple".

This study was previously identified under the legacy study ID S1787
(Status: Published).
Matrices
Title: 18S rDNA and COI
Description: Legacy TreeBASE Matrix ID = M2358
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Paramphinome jeffreysi |
(none)
|
------CTGGTTGATCCTGCCAGTAGTCAT |
| Sthenalanella uniformis |
(none)
|
GCGATTCTGGTTGATCCTGCCAGTAGTCAT |
| Sthenelais boa |
(none)
|
------------------------------ |
| Sige sp |
(none)
|
-------TGGTTGATCCTGCCAGTAGTCAT |
| Sigalion spinosa |
(none)
|
------------------------------ |
| Platynereis dumerlii |
(none)
|
------------GATCCTGCCAGTAGTCAT |
| Pisione remota |
(none)
|
------------------------------ |
| Pholoe sp |
(none)
|
---------GTTGATCCTGCCAGTAGTCAT |
| Paralepidonotus ampulliferus |
(none)
|
--------------------------TCAT |
| Lepidonotus sublevis |
(none)
|
------CTGGTTGATCCTGCCAGTAGTCAT |
| Lepidonotus squamatus |
(none)
|
-------TGGTTGATCCTGCCAGTAGTCAT |
| Harmothoe ocolinarum |
(none)
|
-------TGGTTGATCCTGCCAGTAGTCAT |
| Halsydna brevisetosa |
(none)
|
------CTGGTTGATCCTGCCAGTAGTCAT |
| Gattyana ciliata |
(none)
|
------CTGGTTGATCCTGCCAGTAGTCAT |
| Eumida sp |
(none)
|
------------------------AGTCAT |
| Aphrodita sp |
(none)
|
-------CTGGTGATCCTGCCAGTAGTCAT |
| Aphrodita negligens |
(none)
|
-------TGGTTGATCCTGCCAGTAGTCAT |
| Anaitides sp |
(none)
|
--------GGTTGATCCTGCCAGTAGTCAT |
Columns
None of the columns has a description.