@ARTICLE{TreeBASE2Ref25208,
author = {Pedro W. Crous and Michael J. Wingfield and Johannes J Le Roux and David M Richardson and Dominique Strasberg and Roger G. Shivas and Pablo Alvarado and Jacqueline Edwards and Gabriel Moreno and Rohit Sharma and Mahesh S Sonawane and Yu Pei Tan and Alberto Alt?s and Tharcisse Barasubiye and Charles Wesley Barnes and Robert A Blanchette and David Boertmann and Amauri Bogo and Juan R Carlavilla and Ratchadawan Cheewangkoon and Rosalie Daniel and Z. Wilhelm de Beer and Mar?a de Jes?s Y??ez-Morales and Tuan Duong and Javier Fern?ndez-Vicente and Andrew D.W. Geering and David Ian Guest and Benjamin W Held and Michel Heykoop and Vit Hubka and ahmed mahmoud ismail and Swapnil Kajale and Wanporn Khemmuk and Miroslav Kolař?k and Rashmi Kurli and Renee Lebeuf and C. Andr? L?vesque and Lorenzo Lombard and Donato Magista and Jos? Luis Manj?n and Seonju Marincowitz and Justo Mu?oz Mohedano and Alena Nov?kov? and Nicholas Oberlies and Eric C. Otto and Noemi D. Paguigan and Ian G Pascoe and Jos? Luis P?rez-Butr?n and Giancarlo Perrone and Praveen Rahi and Huzefa A Raja and Tara L Rintoul and Rosa M.V. Sanhueza and Kelly Scarlett and Yogesh Shouche and Lucas Alexander Shuttleworth and Paul W.J. Taylor and R. Greg Thorn and Lynton L Vawdrey and Roney Solano-Vidal and Andrus Voitk and Percy T.W. Wong and Alan R Wood and Juan Carlos Zamora and Johannes (Ewald) Zacharias Groenewald},
title = {Fungal Planet description sheets: 371-399},
year = {2015},
keywords = {ITS DNA barcodes; LSU; novel fungal species; systematics},
doi = {10.3767/003158515X690269},
url = {http://dx.doi.org/10.3767/003158515X690269},
pmid = {26823636},
journal = {Persoonia},
volume = {35},
number = {},
pages = {264--327},
abstract = {Novel species of fungi described in the present study include the following from Australia: Neoseptorioides eucalypti gen. & sp. nov. from Eucalyptus radiata leaves, Phytophthora gondwanensis from soil, Diaporthe tulliensis from rotted stem ends of Theobroma cacao fruit, Diaporthe vawdreyi from fruit rot of Psidium guajava, Magnaporthiopsis agrostidis from rotted roots of Agrostis stolonifera and Semifissispora natalis from Eucalyptus leaf litter. Furthermore, Neopestalotiopsis egyptiaca is described from Mangifera indica leaves (Egypt), Roussoella mexicana from Coffea arabica leaves (Mexico), Calonectria monticola from soil (Thailand), Hygrocybe jackmanii from littoral sand dunes (Canada), Lindgomyces madisonensis from submerged decorticated wood (USA), Neofabraea brasiliensis from Malus domestica (Brazil), Geastrum diosiae from litter (Argentina), Ganoderma wiiroense on angiosperms (Ghana), Arthrinium gutiae from the gut of a grasshopper (India), Pyrenochaeta telephoni from the screen of a mobile phone (India) and Xenoleptographium phialoconidium gen. & sp. nov. on exposed xylem tissues of Gmelina arborea (Indonesia). Several novelties are introduced from Spain, namely Psathyrella complutensis on loamy soil, Chlorophyllum lusitanicum on nitrified grasslands (incl. Chlorophyllum arizonicum comb. nov.), Aspergillus citocrescens from cave sediment and Lotinia verna gen. & sp. nov. from muddy soil. Novel foliicolous taxa from South Africa include Phyllosticta carissicola from Carissa macrocarpa, Pseudopyricularia hagahagae from Cyperaceae and Zeloasperisporium searsiae from Searsia chirindensis. Furthermore, Neophaeococcomyces is introduced as a novel genus, with two new combinations, N. aloes and N. catenatus. Several foliicolous novelties are recorded from La R?union, France, namely Ochroconis pandanicola from Pandanus utilis, Neosulcatispora agaves gen. & sp. nov. from Agave vera-cruz, Pilidium eucalyptorum from Eucalyptus robusta, Strelitziana syzygii from Syzygium jambos (incl. Strelitzianaceae fam. nov.) and Pseudobeltrania ocoteae from Ocotea obtusata (Beltraniaceae emend.). Morphological and culture characteristics along with ITS DNA barcodes are provided for all taxa. }
}
Matrix 48806 of Study 18408

Citation title:
"Fungal Planet description sheets: 371-399".

Study name:
"Fungal Planet description sheets: 371-399".

This study is part of submission 18408
(Status: Published).
Matrices
Title: Roussoella ITS species phylogeny
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Massarina lacustris AF250831 |
(none)
|
------------------------------ |
Roussoella acaciae KP004469 |
(none)
|
TAACTGTTCCGTAGGTGAACCTTCGGAAGG |
Roussoella percutanea KF322117 |
(none)
|
------------------------------ |
Roussoella percutanea KF322118 |
(none)
|
------------------------------ |
Roussoella sp. KF443407 |
(none)
|
------------------------------ |
Roussoella mexicana CPC 25355 |
(none)
|
------------------------------ |
Roussoella neopustulans KJ474833 |
(none)
|
----------------------------GG |
Roussoella japanensis KJ474829 |
(none)
|
----------------------------GG |
Roussoella verrucispora KJ474832 |
(none)
|
----------------------------GG |
Roussoella pustulans KJ474830 |
(none)
|
----------------------------GG |
Roussoella intermedia KJ474831 |
(none)
|
----------------------------GG |
Roussoella chiangraina KJ474828 |
(none)
|
----------------------------GG |
Roussoella siamensis KJ474837 |
(none)
|
----------------------------GG |
Roussoella thailandica KJ474838 |
(none)
|
----------------------------GG |
Roussoella nitidula KJ474834 |
(none)
|
----------------------------GG |
Roussoella nitidula KJ474835 |
(none)
|
----------------------------GG |
Columns
None of the columns has a description.