@ARTICLE{TreeBASE2Ref17296,
author = {Eduardo Ruiz-S?nchez and Victoria Sosa and M. T. Mejia-Saul?s},
title = {Phylogenetics of Otatea Inferred from Morphology and Chloroplast DNA Sequence Data, and Recircumscription of Guaduinae (Poaceae: Bambusoideae)},
year = {2008},
keywords = {},
doi = {10.1600/036364408784571644},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {33},
number = {2},
pages = {277--283},
abstract = {Representative taxa of the five genera of Guaduinae, a subtribe of Neotropical woody bamboos, were sampled to investigate the phylogenetic relationships of the species of the genus Otatea using morphological and molecular (cpDNA intergenic spacer trnH?psbA and the rpl16 intron) evidence. Phylogenetic analysis of a combined data set retrieved 53 most parsimonious trees in which subtribe Guaduinae is monophyletic if two species of Aulonemia (A. clarkiae and A. fulgor) are included. They were previously classified within subtribe Arthrostylidiinae. Guaduinae is supported by the lack of papillae from the abaxial surface, by an almost solid style, a short rachis extension, and oral setae present in culm and foliage leaves. Monophyly of the genera in Guaduinae (Eremocaulon, Guadua, Apoclada, Otatea, and Olmeca) was corroborated. Otatea species formed a monophyletic clade, supported by culms with three subequal ascending branches and pubescent lemmas. Eight species in Guaduinae (the four species in Otatea, Olmeca recta, O. reflexa, Aulonemia clarkiae, and A. fulgor) are distributed in southeastern Mexico in areas determined as Pleistocene refugia. Some of them possess baccoid caryopses and long culm necks, and grow in threatened vegetation types such as cloud, tropical, and tropical deciduous forests, so they are important bamboos to preserve.}
}
Matrix 3746 of Study 1884

Citation title:
"Phylogenetics of Otatea Inferred from Morphology and Chloroplast DNA Sequence Data, and Recircumscription of Guaduinae (Poaceae: Bambusoideae)".

This study was previously identified under the legacy study ID S1860
(Status: Published).
Matrices
Title: Molecular Combined
Description: Legacy TreeBASE Matrix ID = M3422
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Neurolepis aperta |
(none)
|
?????CTCCGGTTGTAATAAGGGGCCACAA |
Glaziophyton mirabile |
(none)
|
?????CACCGATTGCAACAAGTGGTCAAAA |
Aulonemia patula |
(none)
|
?????CACAAATGGCAGTAAGTGGTTCAAC |
Atractantha radiata |
(none)
|
?????CACCAATTGCAA-AAGTGGTCAAAA |
Arthrostylidium ecuadorense |
(none)
|
?????CACCGATGGCAATGCGGGTTCAAAA |
Chusquea bilimekii |
(none)
|
CACCTCTTTAGGTGCGACAAAGGTCCACAC |
Guadua angustifolia |
(none)
|
-GTACTACCGAGTGTAA-GAGTGGTCAAAA |
Aulonemia laxa |
(none)
|
CACCT???????????ATAAGTTGTTAAAC |
Aulonemia clarkiae |
(none)
|
AGTAT???????????ATACGTGGTCAAAA |
Aulonemia fulgor |
(none)
|
AGTATCACCGAGTGTAATAAGTTGTCAAAA |
Rhipidocladum racemiflorum |
(none)
|
CACCTCACCGATTGCAGT-AGTGGTCAAAA |
Guadua aculeata |
(none)
|
AGTACTACCGAGTGTAATGAGTGGTCAAAA |
Guadua velutina |
(none)
|
AGTACTACCGAGTGTAATGAGTGGTCAAAA |
Guadua longifolia |
(none)
|
-GTACTACCGAGTGTAATGAGTGGTCAAAA |
Guadua amplexifolia |
(none)
|
-GTACTTCCGAGTGTAATGAGTGGTCAAAA |
Guadua paniculata |
(none)
|
-GTACTACCGAGTGTAATGAGTGGTCAAAA |
Eremocaulon aureofimbriatum |
(none)
|
-GTACTACCGAGTTTAATAAGTGGTCAAAA |
Eremocaulon asymmetricum |
(none)
|
-GTACTCTCGAGTTTAATAAGTGGTCAAAA |
Olmeca reflexa |
(none)
|
AGTACCACCGAGTGTAATAAGTGGTCAAAA |
Olmeca recta |
(none)
|
-GTATCACCGAGTGTAATACGTGGTCAAAA |
Otatea sp nov |
(none)
|
-GTATCACCGAGTGTAAT-AGTGGTCAACA |
Otatea glauca |
(none)
|
-GTATCACCGAGTGTAAT-AGTGGTCAACA |
Otatea fimbriata |
(none)
|
-GTATCACCGAGTGTAAT-AGTGGTCAACA |
Otatea acuminata |
(none)
|
AGTATCACCGAGTGTAAT-AGTGGTCAACA |
Bambusa vulgaris |
(none)
|
CACCTCTCTGGATGCGATAAAGGGCCCAAA |
Columns
None of the columns has a description.